Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 8,341-8,3608,361-8,3808,381-8,400 ... 18,701-18,718 next last
To: FtrPilot
Russian Railways has practically stopped cargo transportation in Russia

Russian Railways has stopped sending containers to one of the main container terminals in the Moscow region, Selyatino , for 10 days, according to company employees working with this terminal.

The restriction is in effect from November 12 to 21 and is due to the fact that the terminal is overcrowded and the Moscow Railway is overloaded , according to Russian Railways documents.

The situation is similar in another large terminal – Elektrougli . Trains with containers cannot get there either – they have been standing for more than 10 days approximately 1000 kilometers from the capital, between Perm and Kirov.

Delivery delays are huge – a month is considered a good time, and two months are no longer uncommon – key stations on the import route from the Far East to Central Russia are clogged with abandoned trains, from which the locomotive has been uncoupled and left on sidings for an indefinite period, shippers say.

In most cases, Russian Railways explains the need to leave a train without service by a shortage of rolling stock and locomotive crews, employees of transport companies explain. The company is short 2.5 thousand drivers, said Deputy General Director of Russian Railways Dmitry Shakhanov.

The problem is so serious that in early November, the heads of several major railway operators complained about Russian Railways to presidential adviser Igor Levitin . They write that their clients-shippers are increasingly faced with a lack of wagons for loading. According to their estimates, already in mid-October, 35-40% of cargo intended for shipment to the central part of the country was not loaded on the West Siberian Railway.

https://x.com/PStyle0ne1/status/1857773132548899293

8,361 posted on 11/16/2024 6:15:29 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8358 | View Replies]

To: AdmSmith
🇩🇪 🇺🇦 FDP leader Christian Dürr wants to see his party in the next government – ​​and supply Taurus cruise missiles to Ukraine, - NOZ

🚀 He may put the issue of supplying Ukraine with Taurus missiles to a vote in the Bundestag.

https://x.com/UkrReview/status/1857755589905944900


8,362 posted on 11/16/2024 6:19:50 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8359 | View Replies]

To: AdmSmith
...The company is short 2.5 thousand drivers...

Perhaps north korea could supply some train drivers.

8,363 posted on 11/16/2024 6:24:29 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8361 | View Replies]

To: JonPreston

That image is so photoshopped.


8,364 posted on 11/16/2024 6:48:56 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8348 | View Replies]

To: FtrPilot

Excavator type allows demining up to 800 square meters. m per hour


So that’s 8 X 100 meter strip an hour. Or 10 hours to go 1 kilometer. Sitting duck going slow, drone target.


8,365 posted on 11/16/2024 6:56:35 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8358 | View Replies]

To: AdmSmith

Russian Railways explains the need to leave a train without service by a shortage of rolling stock and locomotive crews, employees of transport companies explain. The company is short 2.5 thousand drivers

Shortage explained in 6 lines.

Where all the men have gone,
Gone to war everyone,
When will they ever learn?

Where have all the soldiers gone?
Gone to graveyards, every one
When will they ever learn?


8,366 posted on 11/16/2024 7:02:37 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8361 | View Replies]

To: FtrPilot

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Russian Marines Suffer Heavy Losses in Kursk Assault ]


Today [ Nov 16 ], the biggest news comes from the Kursk direction.

Here, Russians continued the 3rd wave of their counteroffensive, trying to overcome Ukrainian defenses with a new tactical approach. Despite disastrous results, Russian commanders stubbornly refused to change their tactics, leading to many Russian marines finding a watery grave.

The main Russian goal in this stage of their counteroffensive is to penetrate the Ukrainian defenses in a pincer maneuver, and take the northern front of the Ukrainian incursion into a pocket.

Recently, Russians decided to double down on their assaults on Novoivanovka, assuming they were on the brink of collapsing Ukrainian lines. This time, Russians tried to use a different tactic, assaulting the settlement head-on from the east to distract Ukrainians, while launching a flanking attack from the south.

A small river runs south of Novoivanovka, with only 1 bridge that Russians must cross to enter the town from the south. Unfortunately for Russians, Ukrainians were prepared, holding an all-round defense in the settlement, and the Russian flanking attacks being exposed to more Ukrainian fire from the south as they tried to cross the river.

Ukrainians shared geolocated footage of one of these assaults, as the Russian column started hitting landmines as soon as they left the town of Liubimovka. As they crossed into the southern fields, many Russian vehicles were hit and caught fire. At the same time, the infantry prematurely dismounted in a desperate attempt to reach the safety of the forest.

Only 1 of the 6 Russian vehicles managed to enter the settlement in the end, but was ambushed and disabled by a Ukrainian anti-tank weapon, whereafter Ukrainians quickly finished off the scattered Russian infantry.

Despite the Russian attack failing, and Ukrainians now knowing the Russian plan of attack, Russian commanders ordered another 5 waves of mechanized assaults in the same way as before. Expectedly, these attacks ended even worse for Russian forces, as Ukrainians now knew the exact Russian plan of attack, along with Russians not changing their tactics in the slightest.

Ukrainians continued to share geolocated footage of them repulsing the Russian frontal and flanking assaults, showing many burning Russian armored personnel carriers failing to cross the river.

Released footage of the aftermath of the Russian assaults at the river crossing, shows that the Russian marines of the 810th Naval Infantry Brigade suffered heavy casualties in their attempted flanking maneuver. The footage grimly shows the river banks and the reeds being littered with dead Russian soldiers and destroyed armored vehicles.

Ukrainian soldiers active in the region state that the activity of Russian forces in the Kursk direction remains steady. They add that Russians regularly deploy armored vehicles along their main attack vectors, which get destroyed before they can achieve any significant breakthrough.

The Institute for the Study of War reports that the Russian military frequently transfers new reserves to the Kursk region to replace high personnel and equipment losses.

Overall, Ukrainian units have even described their defensive situation as stable, despite defending against the 3rd wave of the Russian counteroffensive, and coming under near-constant Russian assault. Thanks to frequent rotations, Ukrainian soldiers in the Kursk region remain well-rested and more able to leverage their superior training and equipment to achieve tactical victories on the battlefield.

This allows Ukrainians to quickly adapt to the constantly changing situation, and effectively respond to new Russian tactics. As Russian losses rapidly mount and their progress stalls, Russians are quickly depleting their more elite assault units, further diminishing their prospects of breaking through Ukrainian lines.


8,367 posted on 11/16/2024 7:13:27 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8359 | View Replies]

To: Mr. Lucky

Tulsi Gabbard: Zelensky now has absolute control of Ukrainian media, outlawed opposition political parties and Ukraine’s Orthodox Church, declared martial law, and uses absolute power under martial law to cancel presidential elections. pic.twitter.com/X6iBXS9aVy— Catch Up (@CatchUpFeed) November 14, 2024


8,368 posted on 11/16/2024 7:41:23 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 8360 | View Replies]

To: PIF

🚨Update: Zelensky is stealing money like crazy, getting ready to flee Ukraine once it collapses, and hiding money in different banks across the globe. He may seek refuge in France or Egypt, where he owns several villas!!
pic.twitter.com/n27NQxYhWd— US Civil Defense News (@CaptCoronado) November 15, 2024


8,369 posted on 11/16/2024 7:44:55 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 50 | View Replies]

To: PIF

LOL!


8,370 posted on 11/16/2024 7:56:06 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8366 | View Replies]

He Big screwed now

ZELENSKY: WE WILL NOT SIT AND LISTEN EVEN IF TRUMP SAYS SO



“We are an independent Ukraine…This is how we should treat any country, any people, any leader, to respect…This is equality that we’re fighting for today.”pic.twitter.com/kHDb5iUWeR— Mario Nawfal (@MarioNawfal) November 16, 2024


8,371 posted on 11/16/2024 9:03:13 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 8368 | View Replies]

To: AdmSmith

Kremlin snuff box, 11/16/24
https://t.me/s/kremlin_secrets

In the unrest in Abkhazia they saw the trace of Erdogan, “revenge for Crimea” and a threat to Moscow

Some sources in the Kremlin are sure: Turkey is involved in the events in Abkhazia, which is “trying to spoil” Russia. They asked us to publish this version to show that “Moscow understands everything and will react.”

“It’s no secret that Erdogan recently again tried to gain control of Crimea, and Vladimir Vladimirovich once again sent him ( we wrote about this - ed. ). The Turks decided to use their influence in the Caucasus to take revenge, spoil Russia, destabilize Abkhazia and disrupt things that are beneficial to us. Let’s see what comes of this,” said one of our interlocutors.

According to another, ill-wishers ( this could be either Erdogan or the West ) “have launched a very unpleasant scenario of a color revolution in the Caucasus.”

“It just seems like Abkhazia is far away. The organizers of a color revolution always pursue one goal - to change power in a particular country and show that this can be done everywhere.

“A signal is transmitted from Sukhumi to Moscow - look, you can just get together and overthrow the President. And this is a very dangerous story that we will have to fight,” noted the interlocutor in the AP.

It must be said that not everyone in the Kremlin sees the situation in this way. But several people, whom Vladimir Putin listens to, are confident in this version of what is happening in Abkhazia.


8,372 posted on 11/16/2024 1:14:16 PM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8370 | View Replies]

To: PIF; BeauBo
⚡️Last night, one of the 🇷🇺 Russian Borisoglebsk-2 electronic warfare system's vehicle stations was destroyed in the Pokrovsky direction.

The cost of the system, according to some estimates, is about $200 million.

The work of 🇺🇦 "Birds of Magyar".

https://x.com/front_ukrainian/status/1857827940576202849


8,373 posted on 11/16/2024 1:46:59 PM PST by FtrPilot
[ Post Reply | Private Reply | To 8372 | View Replies]

To: FtrPilot

OT:
SpaceX Flight 6 has been pushed back to Tuesday.


8,374 posted on 11/16/2024 1:57:37 PM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8373 | View Replies]

To: PIF
Rybar and other Russian milbloggers report that several Russian commanders have been dismissed and arrested for falsifying reports. The army commander, the chief of staff of the 3rd Army, and the brigade commander of the 7th Brigade have allegedly been arrested, while battalion commanders have been removed. Inspections ‘are also underway in the 6th and 123rd Brigades in the same sector.’

The events pertain to the Siversk direction in the Donetsk region. These commanders allegedly lied about capturing settlements such as Serebrianka, Hryhorivka, Bilohorivka, and Verkhnokamianske. For several months, they reported the capture of these locations, which was entirely false. The truth came to light only when senior officers arrived to inspect Bilohorivka, which was supposed to be in the rear. Meanwhile, correspondents visited positions, and everything was meticulously "documented" on paper.

As Russians themselves lament, "The commanders didn’t care about the fate of their soldiers; their main goal wasn’t to defeat the enemy but to report ‘progress.’”

One can only thank these commanders for such marvelous "progress." However, the disappointment of the bloggers is puzzling—after all, their entire country is built on total lies aimed at impressing superiors, because a totalitarian regime simply cannot function otherwise. It's in the same vein as the infamous "Kyiv in three days." And ultimately, this will be their undoing.

https://x.com/wartranslated/status/1857887269400535303

"... the disappointment of the bloggers is puzzling—after all, their entire country is built on total lies aimed at impressing superiors, because a totalitarian regime simply cannot function otherwise...."

8,375 posted on 11/16/2024 2:35:33 PM PST by FtrPilot
[ Post Reply | Private Reply | To 8373 | View Replies]

To: PIF
HIMARS strike in Zaporizhzhia region! ☠️🔥

https://x.com/Maks_NAFO_FELLA/status/1857899759026987494


8,376 posted on 11/16/2024 3:04:34 PM PST by FtrPilot
[ Post Reply | Private Reply | To 8375 | View Replies]

To: PIF

The locals are reacting to a law proposed by the Russian puppet government that would allow Russians to purchase land in occupied Georgia. This would lead to the occupied Georgian region of Abkhazia becoming defacto Russian territory. Short of an uprising by the people, that ship has pretty much sailed.


8,377 posted on 11/16/2024 5:28:21 PM PST by ETCM (“There is no security, no safety, in the appeasement of evil.” — Ronald Reagan)
[ Post Reply | Private Reply | To 8372 | View Replies]

To: BeauBo

🚨Update: "The United States cannot force Ukraine to sit at the negotiating table!”

-Volodymyr Zelensky pic.twitter.com/bEwE8M4Szp— US Civil Defense News (@CaptCoronado) November 17, 2024


8,378 posted on 11/16/2024 5:34:58 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 8301 | View Replies]

To: PIF
The entire Russian assault group uses exclusively light unarmored civilian vehicles.

I think I've never seen anything like this before.

https://x.com/bayraktar_1love/status/1857934670958149697


8,379 posted on 11/16/2024 5:38:06 PM PST by FtrPilot
[ Post Reply | Private Reply | To 8376 | View Replies]

To: PIF
“Maze Runner”. Russian edition.

https://x.com/bayraktar_1love/status/1857791725437071585


8,380 posted on 11/16/2024 5:40:08 PM PST by FtrPilot
[ Post Reply | Private Reply | To 8379 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 8,341-8,3608,361-8,3808,381-8,400 ... 18,701-18,718 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson