Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 0putinsfolly; 0putinswar; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynow; anydaynowputinwins; anydaynowrussiawins; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; jonputinbot; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 8,301-8,3208,321-8,3408,341-8,360 ... 22,121-22,139 next last
To: PIF
⚡️🇺🇦 Ukraine to receive weapons from 🇺🇸 US every week - Pentagon.

This is necessary in order to have time to use $7.1 billion before Biden leaves office.

https://x.com/front_ukrainian/status/1857176576154124485


8,321 posted on 11/15/2024 4:47:44 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8320 | View Replies]

To: PIF
1/ Russian military authorities are reported to have rescued 17 soldiers from their own commander, who was holding them prisoner, torturing them and stealing their salaries.

Other soldiers are said to have been murdered, with their deaths covered up by compliant medics.

https://x.com/ChrisO_wiki/status/1857175070197637319

More commentary at the link above.

8,322 posted on 11/15/2024 4:51:00 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8321 | View Replies]

To: PIF
Russian Telegram channels report a drone attack on Russian Krasnodar region, probably on Krymsk military airfield.

Russian defense ministry said up to 40 drones attacked Krasnodar region.

https://x.com/Gerashchenko_en/status/1857310017789051159

Krasnodar on Google Maps

8,323 posted on 11/15/2024 4:57:05 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8322 | View Replies]

To: FtrPilot
🇰🇵 🇷🇺 North Koreans are in Kursk, and pretty close to Ukrainian forces as well... Interesting stories from Russian POW's.

I've been told that captured Russian soldiers from the 810th Guards Naval Infantry Brigade revealed that they have been instructed to only mention Buryats when asked about foreign fighters, avoiding any reference to North Koreans. In the Kursk region, there is a camp only 25km away from Ukrainian positions, occupied by North Korean forces who operate independently under their own commanders. These troops are highly strict and protective; a Russian soldier that mistakenly entered their zone, was nearly shot.

Additional intelligence from another Russian prisoner indicated that there were about 15 North Korean soldiers at another training range. During an accident involving an RGD-5 hand grenade one North Korean soldier got injured, after which the entire group was withdrawn from the range.


8,324 posted on 11/15/2024 5:02:16 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8323 | View Replies]

To: PIF
Recent work by the 36th Marine Brigade in the Kursk region, destroying Russian equipment and infantry positions.

https://x.com/NOELreports/status/1857400007868985849


8,325 posted on 11/15/2024 5:11:54 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8324 | View Replies]

To: PIF
⚡️Yaroslav Kurcheyev, the battalion commander of the 200th separate motorized rifle brigade of the Northern Fleet of the 🇷🇺 Russian Federation, was killed in 🇺🇦 Ukraine.

https://x.com/front_ukrainian/status/1857357226891153618


8,326 posted on 11/15/2024 5:14:57 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8325 | View Replies]

To: PIF
Europe must strengthen its air defence capabilities. Announced today that 🇸🇪 Sweden together with 🇩🇪 🇪🇸 🇳🇱 🇷🇴 will jointly procure 1,000 Patriot missiles. Sweden is investing over 5 billion SEK in this initiative to boost its air defence capabilities.

https://x.com/PlJonson/status/1857391262233428377

Most likely PAC-3 Hit to Kill missiles.

8,327 posted on 11/15/2024 5:45:24 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8326 | View Replies]

⚡️🔥FPV drone strike on 🇷🇺 Russian orc-invader by the 🇺🇦 Ukrainian 47th Mechanised Brigade.

https://x.com/GloOouD/status/1857333132548067689


8,328 posted on 11/15/2024 5:48:44 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8327 | View Replies]

To: PIF
🔥A 🇷🇺 Russian invader laid down to sleep on 🇺🇦Ukrainian soil, but the drone operator AEROBOMBER interrupted his sleep.

https://x.com/GloOouD/status/1857352064633798880


8,329 posted on 11/15/2024 5:51:19 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8328 | View Replies]

To: PIF
On the basis of multiple sources the BBC concluded that the typical time a Russian soldier will live after signing his military contract is 12 days.

Other sources say 12-18 days until MIA or KIA.
MIA means: killed, but without payment.
Signing = suicide + payment raffle.

https://x.com/ReneDuba/status/1857396807447261499

Russia doesn't pay the family of soldiers missing in action and they are the majority.


8,330 posted on 11/15/2024 5:56:48 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8329 | View Replies]

To: FtrPilot

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Ukrainian Forces Push Back and Retake Terny! ]


Today [ Nov 15 ], we have a lot of updates from the Lyman direction.

In their relentless push toward Terny, Russian forces ultimately reached the settlement but at a high cost, leading to an abrupt culmination of the local offensive. Sensing this shift, Ukrainian forces launched intense counterattacks to reclaim lost ground, driving the exhausted Russian units to a standstill.

In recent days, Russian forces have intensified their assault on Terny, advancing both from the northern road and across open fields to the east. Terny has become a strategic priority for Russia, serving as a key node in Ukrainian defenses on the eastern bank of the Zherebets River.

Capturing Terny could potentially lead to a collapse of Ukrainian positions along this bank. To achieve this, Russia has committed some of its best units, drawn from the 144th Motorized Rifle Brigade.

Two primary factors explain Russia’s initial advances toward Terny.

First, Russian forces leveraged air support, with intense FAB-500 bombardments targeting Ukrainian positions in Terny, closely coordinated with advancing infantry.

Second, the Ukrainians now lack the substantial buffer zone that previously slowed Russian advances. Earlier, Russian forces had to traverse about 16 kilometers in a single push to engage, whereas now they can gradually amass in northern settlements, enabling shorter, rapid assaults and leaving Ukrainian defenders with far less reaction time.

The Russian operation relied on successive, continuous waves of assaults, which encountered fierce resistance from Ukrainian artillery and FPV drones. Numerous geolocated videos have surfaced, highlighting significant Russian personnel and equipment losses.

Some footage shows personnel carriers destroyed by Ukrainian FPV drones and anti-tank guided missiles. Other clips capture dismounted Russian infantry attempting to advance on foot toward Terny, only to be detected and eliminated by small arms fire and FPV drones.

However, various military analysts have raised concerns about the sustainability of Russian operations, due to high casualty rates, driven by 2 primary factors.

First, Ukrainian forces maintain a fire control advantage from elevated positions on the west bank, giving them a clear view of Russian movements and enabling precise coordination of ground forces, artillery, and FPV drone strikes.

Second, Russian logistics remain overextended, complicating the steady supply of ammunition and food, despite the buildup of infantry north of Terny. Additionally, the severe destruction of structures within Terny has hindered Russia’s ability to secure and consolidate positions.

Eventually, staggering losses depleted Russia’s infantry reserves in the area, stalling their advance. Poor planning and logistical challenges led to the culmination of the Russian offensive, providing Ukrainian forces an opportunity to counterattack. Recognizing the area’s strategic importance, the Ukrainian command deployed reserve units along the Terny-Torske road, enabling a series of intense counterattacks.

These efforts allowed Ukrainian forces to reclaim much of Terny. Although Russian troops briefly reached the settlement center, they were ultimately forced back and pushed out of Terny’s northern edge completely.

Overall, Russian forces committed significant resources, including some of their best units, to high-cost assaults to reach Terny. However, they quickly depleted their reserves and were met with effective Ukrainian counterattacks, reinforced from Torske. For now, Russian advances to the south have been contained, but Ukrainian forces remain vigilant.

There is still a risk that Russian troops could renew efforts to block the main Torske-Terny road. In response, Ukrainian command is expected to continue deploying reserve units to secure their positions and contain Russian forces east of the Zherebets River.


8,331 posted on 11/15/2024 6:37:00 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8330 | View Replies]

To: PIF
If you think Kursk is the only place the russian bitches are getting stuffed, think again.

In the Siversk direction, soldiers of the 10th Mountain Assault Brigade and the 54th Mechanized Brigade shredded a large mechanized assault.

https://x.com/NAFORaccoon/status/1857076820614566221


8,332 posted on 11/15/2024 7:30:39 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8330 | View Replies]

To: FtrPilot

German Chancellor Scholz had his first phone call with Putin in two years. How did it go?

Kyiv Independent reports:

“The German Economy Ministry instructed its state-operated gas import terminal to reject a delivery of Russian liquefied natural gas (LNG), the Financial Times (FT) reported on Nov. 14…

The ministry told the Deutsche Energy Terminal “not to accept any deliveries of Russian LNG” after receiving notice that the facility was expecting a shipment in the coming days. The port was instructed “to reject LNG deliveries from Russia until further notice,” according to a letter from the ministry viewed by FT.”


8,333 posted on 11/15/2024 7:47:21 AM PST by BeauBo
[ Post Reply | Private Reply | To 8320 | View Replies]

To: FtrPilot

8,334 posted on 11/15/2024 8:35:21 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8279 | View Replies]

To: AdmSmith

OT:
SpaceX Flight 6 scheduled foe Monday. This Starship flight test aims to expand the envelope on ship and booster capabilities and get closer to bringing reuse of the entire system online.

Objectives include the booster once again returning to the launch site for catch, reigniting a ship Raptor engine while in space, demonstrating the capabilities required to conduct a ship deorbit burn prior to orbital missions, and testing a suite of heatshield experiments and maneuvering changes for ship reentry and descent over the Indian Ocean.

Hardware upgrades for this flight add additional redundancy to booster propulsion systems, increase structural strength at key areas, and shorten the timeline to offload propellants from the booster following a successful catch. Mission designers also updated software controls and commit criteria for the booster’s launch and return.

Several thermal protection experiments and operational changes will test the limits of Starship’s capabilities and generate flight data to inform plans for ship catch and reuse. The flight test will assess new secondary thermal protection materials and will have entire sections of heat shield tiles removed on either side of the ship in locations being studied for catch-enabling hardware on future vehicles.

The ship also will intentionally fly at a higher angle of attack in the final phase of descent, purposefully stressing the limits of flap control to gain data on future landing profiles. Finally, adjusting the flight’s launch window to the late afternoon at Starbase will enable the ship to reenter over the Indian Ocean in daylight, providing better conditions for visual observations.

Future ships, starting with the vehicle planned for seventh flight test, will fly with significant upgrades including redesigned forward flaps, larger propellant tanks, and the latest generation tiles and secondary thermal protection layers as we continue to iterate towards a fully reusable heat shield.

Learnings from this and subsequent flight tests will continue to make the entire Starship system more reliable as we close in on full and rapid reusability.

https://freerepublic.com/focus/f-chat/4278642/posts


8,335 posted on 11/15/2024 9:58:27 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8334 | View Replies]

To: FtrPilot

Kremlin snuff box, 11/14/24
https://t.me/s/kremlin_secrets

The military complains about fighters from the DPRK. There are rumors that they will be sent to barrier detachments and placed behind our guys

Several officers who are fighting in the Kursk region told us that the arrival of military personnel from the DPRK at the front did not have a particularly positive impact on the course of hostilities.

“The Koreans are so-so prepared. There are normal ones, they learn a lot from our guys, it’s clear how much they value their new experience. And there are those who don’t want to learn anything. There are also many wild ones among them - they mutter something in their own way, they are rude, they conflict with us ( we wrote about one of these conflicts - ed. ). There are also those who harass local women. They behave disgustingly,” noted one of the interlocutors.

Another reported alarming rumors: “They say that they want to create barrier detachments from the Koreans so that they stop those who chicken out and do not allow them to retreat from the battlefield. After all, they fight so-so, but it’s easy to stand behind them and shoot at our guys.

“Whether they are us or the enemy... It doesn’t matter to them.” We received the same data from several other officers - and not only from the Kursk region. The military is discussing similar things in the DPR and Zaporozhye region.

A source in the Ministry of Defense commented on this information: “We try not to practice barrier detachments. But, I won’t hide it, this happens. I hope there will be no barrier detachments from representatives of the army of our North Korean partners.

“But such decisions are usually made by local commanders. In general, to be honest, I’m tired of rumors about the military from the DPRK. How long can we discuss this?”

Our interlocutor refused to comment on our remark that Korean fighters could replace Chechen military personnel in the barrier detachments (it’s no secret what we’re talking about).

It should be noted: rumors about the North Koreans and detachments from them have not been fully confirmed. But we are surprised that only one source in the Ministry of Defense commented on the topic. Others avoid answering - they do not want to either refute or confirm this information.


8,336 posted on 11/15/2024 2:07:23 PM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8332 | View Replies]

To: BeauBo

Kremlin snuff box
https://t.me/s/kremlin_secrets

Scholz called Putin. Two important points about this

On Friday, a conversation took place between Vladimir Putin and Olaf Scholz. The conversation is important and, admittedly, long-awaited. The last personal contact between the leaders was in December 2022.

What’s this time? The conversation was initiated by the German side. It is curious that the Kremlin previously refused to communicate with Macron. And the conversation took place with Scholz.

“Historically, our relations with the Germans are stronger than with the French,” the Kremlin explained.

The Ukrainian side tried to disrupt the dialogue, but this did not happen. And this is a positive thing.

“The President made it clear that we are not against the world. But on our terms. There is reason to believe that this is the first conversation in a series of dialogues that should take place in the near future. And it is useful for us to show that we are not in any way isolated We talk to whoever we want, on our terms,” said a source in the AP.

But there is also a moment. Some hawks around Vladimir Putin expressed dissatisfaction with the conversation.

“We have successes at the front. Trump won the elections. Why talk to these Scholtz-Macrons? Let them stand in line and wait. I don’t know why Vladimir Vladimirovich is talking to them about something,” said one of the prominent hawks.

Rumor has it that Scholz hinted that if peace cannot be achieved in the next six months, then new sanctions will be imposed against Russia, and Europe will reconsider its approach to security issues in the region.


8,337 posted on 11/15/2024 2:08:56 PM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8333 | View Replies]

🇩🇪🇷🇺 Scholz pre-election tries to make peace!

Olaf Scholz spoke with Vladimir Putin by phone, the Süddeutsche Zeitung newspaper reports. This is the first conversation between the German Chancellor and the Russian President since December 2022. The conversation lasted one hour,… pic.twitter.com/mivvqhEYif— Lord Bebo (@MyLordBebo) November 15, 2024


8,338 posted on 11/15/2024 3:38:15 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 8337 | View Replies]

To: JonPreston
"For as long as it takes"


8,339 posted on 11/15/2024 4:01:13 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 8338 | View Replies]

To: BeauBo
SORRY, WE’RE CLOSED? Russian sources report that at least three Russian oil refineries could face closures next year as drone attacks, declining exports, high crude oil costs and soaring interest rates lead to mounting financial losses.

https://x.com/ChuckPfarrer/status/1857493445176135864

More bad news for ruzzia, the enemy of all mankind.

8,340 posted on 11/15/2024 4:57:43 PM PST by FtrPilot
[ Post Reply | Private Reply | To 8332 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 8,301-8,3208,321-8,3408,341-8,360 ... 22,121-22,139 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson