Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 8,261-8,2808,281-8,3008,301-8,320 ... 18,761-18,774 next last
Slovakia’s Fico announces halt of military aid to Ukraine

LINK

Slovakia's newly elected Prime Minister Robert Fico pledged on Thursday to stop delivering weapons to Ukraine, just one day after taking office.

The prime minister told lawmakers that Slovakia would "no longer supply weapons to Ukraine" and would only send humanitarian aid to Kyiv, according to French newswire AFP.

"I will support zero military aid to Ukraine ... An immediate halt to military operations is the best solution we have for Ukraine," said Fico,

Hail Slovakia, hail it's glorious Leader!

8,281 posted on 11/14/2024 3:24:38 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 8277 | View Replies]

To: AdmSmith
The russians are being absolutely crushed in Kursk.

Around 100 vehicles and 1,000 chimps have been destroyed in just the last two days.

https://x.com/NAFORaccoon/status/1856810698048753948


8,282 posted on 11/14/2024 3:49:22 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8279 | View Replies]

To: PIF
Russian toast 😋

https://x.com/mouw5284/status/1856737143466438844


8,283 posted on 11/14/2024 3:51:08 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8282 | View Replies]

To: PIF
A Ukrainian M2A2 Bradley IFV, recorded by the 95th Air Assault Brigade, fires at Russian BTR-82A's loaded with troops. Reportedly in the Kursk region.

https://x.com/NOELreports/status/1857007414584701298

M2A2 Bradleys are operating in Kursk.

8,284 posted on 11/14/2024 3:55:25 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8283 | View Replies]

To: PIF
After the elimination of the Russian Black Sea Fleet's missile ship chief in Crimea, reports indicate that other senior officers and their families have moved to Novorossiysk.

"Some of the leadership and their families have already relocated, and both the fleet and personnel are now effectively stationed in Novorossiysk," Navy Spokesperson Dmytro Pletenchuk said.

https://x.com/NOELreports/status/1856975969963167927

Novorossiysk on Google Maps


8,285 posted on 11/14/2024 4:00:06 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8284 | View Replies]

To: PIF
This is what a "superpower" looks like.

https://x.com/osint_69/status/1856822331319976344


8,286 posted on 11/14/2024 4:02:22 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8285 | View Replies]

To: PIF
Russia tried once again to break through the defense of the 79th Brigade near Kurakhove.

Artillery, mortars, attack drones, anti-tank missile systems, and minefields were used to repel the attack.

This video shows the destruction of Russian tanks, armored vehicles, and the elimination of Russian infantry.

https://x.com/NOELreports/status/1856991420034216170


8,287 posted on 11/14/2024 4:10:08 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8286 | View Replies]

To: JonPreston

🚨🇺🇦UKRAINE TO BUILD NUCLEAR BOMB IF U.S. AID IS CUT?!

Ukraine could develop a rudimentary nuclear bomb within months if Trump cuts U.S. military aid, according to a document cited by The Times.

The report suggests Ukraine could use plutonium from its reactors to build a bomb… pic.twitter.com/odqGK301eD— Mario Nawfal (@MarioNawfal) November 14, 2024


8,288 posted on 11/14/2024 4:14:03 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 8281 | View Replies]

To: All
More ruzzian tanks being destroyed, most likely in Kursk.


8,289 posted on 11/14/2024 4:19:21 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8287 | View Replies]

To: PIF
The Ukrainian Air Force reported on a drone attack overnight.

All 59 Shahed drones that were launched were taken down by air defense (21) or electronic warfare (38).

https://x.com/NOELreports/status/1856952887206711726

None of the drones reached their target.


8,290 posted on 11/14/2024 4:22:28 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8289 | View Replies]

To: PIF
Russian sources share photo which suggests that North Korea has began shipping M-1978 'Koksan' 170 mm self-propelled gun of North Korean manufacture to Russia.

Visually those are very similar to 2S7 'Pion' 203mm SPG.

https://x.com/bayraktar_1love/status/1857026675428479481


8,291 posted on 11/14/2024 4:27:34 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8290 | View Replies]

To: PIF
Russian BMP masterfully disembarks infantry right under Ukrainian drones.

Episode 2.

https://x.com/bayraktar_1love/status/1857020866636251278

In the video, the BMP driver drives off, leaving dead and wounded to fend for themselves.


8,292 posted on 11/14/2024 4:30:25 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8291 | View Replies]

To: PIF
Soldiers of the 11th Brigade of the National Guard of Ukraine, the Lastivka unit, neutralized a Russian Lancet kamikaze drone in flight.

https://x.com/wartranslated/status/1857017824788521308


8,293 posted on 11/14/2024 4:37:21 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8292 | View Replies]

To: FtrPilot

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Ukrainian Forces Pull Off Tactical Masterpiece ]


Today [ Nov 14 ], the biggest news comes from the Kursk direction.

Here, Ukrainians perfectly executed a complex tactical maneuver to eliminate the Russian spearhead, while maintaining their combat potential, leading to the complete encirclement of the Russian assault group. The Russian relief operation launched on the Ukrainian flanks also ended in disaster, leading to Russian casualties soaring to an all-time high.

As you may remember from the last report, Ukrainians completely dismantled the Russian mechanized assault on Malaya Loknya, destroying 15 armored vehicles with mines and drones.

Still, Russians managed to penetrate quite deep into Ukrainian territory, driving through multiple towns in the northern part of the salient. Ukrainians realized that holding on to settlements in the face of such a large Russian mechanized attack would come at a high cost to Ukrainian forces. This led to Ukrainians temporarily abandoning the settlements and pulling back toward better positions.

If we look at the topographic map, we can see that the road and settlements leading to Malaya Loknya run through the lowlands, surrounded by forests and hills to the west and east. Ukrainians withdrew from the settlements to the high ground, letting the Russian convoy pass through, and allowing it to be destroyed by previously placed mines and FPV drones.

Russians dropped off several smaller infantry groups in the settlements they drove past. The Russian plan was for these groups to take up an all-round defense and secure the road for additional reinforcements to pass through in the future.

However, these groups were left vulnerable and without support after the mechanized forces were destroyed. Meanwhile, Ukrainians had saved their combat power by not engaging the Russian assault outright, and were in a much stronger position in the forests and on top of the hills.

As Russians did not have enough soldiers to cover the settlements completely, Ukrainians rapidly moved into the gaps and encircled the Russian soldiers stuck in the settlements. The Russians realized the disaster that was unfolding and sent in several armored vehicles to break through to the encircled soldiers.

Unfortunately for the Russians, this time, Ukrainians did not allow the Russians to pass through, as geolocated footage shows several Russian armored vehicles being destroyed by Ukrainian defenders. Russian military analysts later confirmed that no reinforcements were able to break through to their soldiers and that these groups had been fully cut off for days, relying solely on supplies dropped from drones.

To salvage the situation and turn the tide of the battle, Russians increased the pressure on the Ukrainian western flank, launching five waves of mechanized assaults on Novoivanovka in only one day.

Here is where Ukrainians inflicted massive casualties on Russian forces, destroying 18 out of 29 Russian armored vehicles in the process. Still, Russians were able to land several infantry groups in the settlement and the tree lines around it, posing a substantial threat to the Ukrainian western flank.

Ukrainians promptly dealt with the Russian threat by sending in several mechanized assault groups, supported by Bradley Infantry Fighting vehicles, to clear out the Russian positions.

Impressively, the Ukrainian modifications to the Bradley’s armor allowed them to shrug off several hits by Russian FPV kamikaze drones, and safely deploy their infantry to clear the positions.

Overall, Ukrainians demonstrated expert control of the situation and their movements, allowing them to gain tactical superiority over the Russian assault forces. Executing a maneuver, such as withdrawing from the settlements and returning, during actual combat, takes expert timing and coordination, which is only possible with well-trained and rested soldiers.

Russian casualties soared, as Ukrainian soldiers noted that the Russians had lost over three hundred men during their failed assaults on Novoivanovka and the subsequent Ukrainian counterattacks. Russian analysts were also among the first to state that Ukrainians had effectively localized the threat of the initial Russian spearhead and took back control over the settlements.

Now, the only danger to Ukrainian operations is the fact that the encircled Russian soldiers are located directly on the Ukrainian supply road to Pogrebki. However, with the threat of Russian attacks from the west being dealt with, Ukrainians can now focus on destroying the encircled Russian soldiers and reestablishing complete control over the area.


8,294 posted on 11/14/2024 4:44:06 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8293 | View Replies]

To: FtrPilot

Extinguishing tire fires is difficult. The fire releases a dark, rich smoke that contains cyanide, carbon monoxide, sulfur dioxide, and products of butadiene and styrene. Burning tires are heated, and, as they have a low thermal conductivity, they are difficult to cool down.

https://en.wikipedia.org/wiki/Tire_fire

World’s Biggest Tyre Graveyard Kuwait’s Sulaibiya On Fire | Newsmo

https://www.youtube.com/watch?v=xJPxWu0qqiQ


8,295 posted on 11/14/2024 5:52:11 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8286 | View Replies]

To: PIF
Today's entire "report from Ukraine" is amazing.

Thanks for posting & thanks for the ping!

Several of my posts from today contain video documentation of the destruction of ruzzia's forces in Kursk.

Your post describes the strategies & tactics used by UKF to annihilate the ruzzians in Kursk.

8,296 posted on 11/14/2024 7:07:26 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8294 | View Replies]

To: PIF

The bleeding of Russia continues.

The deathwatch of the ruble continues as well.

It dropped to 99.69 to the dollar today.

If they cannot defend the penny ruble this time (as their economic fundamentals and financial conditions continue to degrade), it is an open question as to how far it might fall.


8,297 posted on 11/14/2024 7:49:44 AM PST by BeauBo
[ Post Reply | Private Reply | To 8294 | View Replies]

To: PIF

The bleeding of Russia continues.

The deathwatch of the ruble continues as well.

It dropped to 99.69 to the dollar today.

If they cannot defend the penny ruble this time (as their economic fundamentals and financial conditions continue to degrade), it is an open question as to how far it might fall.


8,298 posted on 11/14/2024 7:49:45 AM PST by BeauBo
[ Post Reply | Private Reply | To 8294 | View Replies]

To: FtrPilot

Thanks. You keep up finding all the X videos which are very good and allow us to see what horrors the guys face in real combat.


8,299 posted on 11/14/2024 7:51:22 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8296 | View Replies]

To: BeauBo

Good info. You seem to have acquired a knack for double posting these days😁


8,300 posted on 11/14/2024 7:52:50 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8298 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 8,261-8,2808,281-8,3008,301-8,320 ... 18,761-18,774 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson