Skip to comments.
Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^
| Since February 24, 2022 and daily
| ORYX
Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas
click here to read article
Navigation: use the links below to view more comments.
first previous 1-20 ... 8,261-8,280, 8,281-8,300, 8,301-8,320 ... 18,701-18,716 next last
Slovakia’s Fico announces halt of military aid to Ukraine
LINK
Slovakia's newly elected Prime Minister Robert Fico pledged on Thursday to stop delivering weapons to Ukraine, just one day after taking office.
The prime minister told lawmakers that Slovakia would "no longer supply weapons to Ukraine" and would only send humanitarian aid to Kyiv, according to French newswire AFP.
"I will support zero military aid to Ukraine ... An immediate halt to military operations is the best solution we have for Ukraine," said Fico,
Hail Slovakia, hail it's glorious Leader!
To: AdmSmith
To: PIF
To: PIF
To: PIF
After the elimination of the Russian Black Sea Fleet's missile ship chief in Crimea, reports indicate that other senior officers and their families have moved to Novorossiysk. "Some of the leadership and their families have already relocated, and both the fleet and personnel are now effectively stationed in Novorossiysk," Navy Spokesperson Dmytro Pletenchuk said.
https://x.com/NOELreports/status/1856975969963167927
![]()
Novorossiysk on Google Maps
![]()
To: PIF
To: PIF
Russia tried once again to break through the defense of the 79th Brigade near Kurakhove. Artillery, mortars, attack drones, anti-tank missile systems, and minefields were used to repel the attack.
This video shows the destruction of Russian tanks, armored vehicles, and the elimination of Russian infantry.
https://x.com/NOELreports/status/1856991420034216170
![]()
To: JonPreston
To: All
More ruzzian tanks being destroyed, most likely in Kursk.
![]()
To: PIF
To: PIF
To: PIF
To: PIF
To: FtrPilot
Reporting From Ukraine:
https://www.youtube.com/@RFU/videos
Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]
The complete transcript.
—
[ Ukrainian Forces Pull Off Tactical Masterpiece ]
—
Today [ Nov 14 ], the biggest news comes from the Kursk direction.
Here, Ukrainians perfectly executed a complex tactical maneuver to eliminate the Russian spearhead, while maintaining their combat potential, leading to the complete encirclement of the Russian assault group. The Russian relief operation launched on the Ukrainian flanks also ended in disaster, leading to Russian casualties soaring to an all-time high.
As you may remember from the last report, Ukrainians completely dismantled the Russian mechanized assault on Malaya Loknya, destroying 15 armored vehicles with mines and drones.
Still, Russians managed to penetrate quite deep into Ukrainian territory, driving through multiple towns in the northern part of the salient. Ukrainians realized that holding on to settlements in the face of such a large Russian mechanized attack would come at a high cost to Ukrainian forces. This led to Ukrainians temporarily abandoning the settlements and pulling back toward better positions.
If we look at the topographic map, we can see that the road and settlements leading to Malaya Loknya run through the lowlands, surrounded by forests and hills to the west and east. Ukrainians withdrew from the settlements to the high ground, letting the Russian convoy pass through, and allowing it to be destroyed by previously placed mines and FPV drones.
Russians dropped off several smaller infantry groups in the settlements they drove past. The Russian plan was for these groups to take up an all-round defense and secure the road for additional reinforcements to pass through in the future.
However, these groups were left vulnerable and without support after the mechanized forces were destroyed. Meanwhile, Ukrainians had saved their combat power by not engaging the Russian assault outright, and were in a much stronger position in the forests and on top of the hills.
As Russians did not have enough soldiers to cover the settlements completely, Ukrainians rapidly moved into the gaps and encircled the Russian soldiers stuck in the settlements. The Russians realized the disaster that was unfolding and sent in several armored vehicles to break through to the encircled soldiers.
Unfortunately for the Russians, this time, Ukrainians did not allow the Russians to pass through, as geolocated footage shows several Russian armored vehicles being destroyed by Ukrainian defenders. Russian military analysts later confirmed that no reinforcements were able to break through to their soldiers and that these groups had been fully cut off for days, relying solely on supplies dropped from drones.
To salvage the situation and turn the tide of the battle, Russians increased the pressure on the Ukrainian western flank, launching five waves of mechanized assaults on Novoivanovka in only one day.
Here is where Ukrainians inflicted massive casualties on Russian forces, destroying 18 out of 29 Russian armored vehicles in the process. Still, Russians were able to land several infantry groups in the settlement and the tree lines around it, posing a substantial threat to the Ukrainian western flank.
Ukrainians promptly dealt with the Russian threat by sending in several mechanized assault groups, supported by Bradley Infantry Fighting vehicles, to clear out the Russian positions.
Impressively, the Ukrainian modifications to the Bradley’s armor allowed them to shrug off several hits by Russian FPV kamikaze drones, and safely deploy their infantry to clear the positions.
Overall, Ukrainians demonstrated expert control of the situation and their movements, allowing them to gain tactical superiority over the Russian assault forces. Executing a maneuver, such as withdrawing from the settlements and returning, during actual combat, takes expert timing and coordination, which is only possible with well-trained and rested soldiers.
Russian casualties soared, as Ukrainian soldiers noted that the Russians had lost over three hundred men during their failed assaults on Novoivanovka and the subsequent Ukrainian counterattacks. Russian analysts were also among the first to state that Ukrainians had effectively localized the threat of the initial Russian spearhead and took back control over the settlements.
Now, the only danger to Ukrainian operations is the fact that the encircled Russian soldiers are located directly on the Ukrainian supply road to Pogrebki. However, with the threat of Russian attacks from the west being dealt with, Ukrainians can now focus on destroying the encircled Russian soldiers and reestablishing complete control over the area.
8,294
posted on
11/14/2024 4:44:06 AM PST
by
PIF
(They came for me and mine ... now its your turn)
To: FtrPilot
Extinguishing tire fires is difficult. The fire releases a dark, rich smoke that contains cyanide, carbon monoxide, sulfur dioxide, and products of butadiene and styrene. Burning tires are heated, and, as they have a low thermal conductivity, they are difficult to cool down.
https://en.wikipedia.org/wiki/Tire_fire
World’s Biggest Tyre Graveyard Kuwait’s Sulaibiya On Fire | Newsmo
https://www.youtube.com/watch?v=xJPxWu0qqiQ
8,295
posted on
11/14/2024 5:52:11 AM PST
by
AdmSmith
(GCTGATATGTCTATGATTACTCAT)
To: PIF
Today's entire "report from Ukraine" is amazing.
Thanks for posting & thanks for the ping!
Several of my posts from today contain video documentation of the destruction of ruzzia's forces in Kursk.
Your post describes the strategies & tactics used by UKF to annihilate the ruzzians in Kursk.
To: PIF
The bleeding of Russia continues.
The deathwatch of the ruble continues as well.
It dropped to 99.69 to the dollar today.
If they cannot defend the penny ruble this time (as their economic fundamentals and financial conditions continue to degrade), it is an open question as to how far it might fall.
To: PIF
The bleeding of Russia continues.
The deathwatch of the ruble continues as well.
It dropped to 99.69 to the dollar today.
If they cannot defend the penny ruble this time (as their economic fundamentals and financial conditions continue to degrade), it is an open question as to how far it might fall.
To: FtrPilot
Thanks. You keep up finding all the X videos which are very good and allow us to see what horrors the guys face in real combat.
8,299
posted on
11/14/2024 7:51:22 AM PST
by
PIF
(They came for me and mine ... now its your turn)
To: BeauBo
Good info. You seem to have acquired a knack for double posting these days😁
8,300
posted on
11/14/2024 7:52:50 AM PST
by
PIF
(They came for me and mine ... now its your turn)
Navigation: use the links below to view more comments.
first previous 1-20 ... 8,261-8,280, 8,281-8,300, 8,301-8,320 ... 18,701-18,716 next last
Disclaimer:
Opinions posted on Free Republic are those of the individual
posters and do not necessarily represent the opinion of Free Republic or its
management. All materials posted herein are protected by copyright law and the
exemption for fair use of copyrighted works.
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson
