Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 7,581-7,6007,601-7,6207,621-7,640 ... 21,001-21,009 next last
To: SpeedyInTexas

Kremlin snuff box, 10/26/24
https://t.me/s/kremlin_secrets

Iran is unhappy with Russian air defense, but asked for more

Last night, military installations in Iran were attacked by Israel. All Iranian air defense forces were involved in repelling the attack, but this was not enough. Some of the targets were shot down, but some of the objects were actually damaged ( we will not name specific targets, due to the difficulty of verification on Union territory ).

Intelligence records that the top of the Iranian army is dissatisfied with the results of repelling the attack. In particular, how the S-400 systems transferred from Russia performed. According to rumors, at least two installations were damaged.

But the most important thing is that already at about 10 am Moscow time, Sergei Shoigu received a call from Tehran. In addition to the attack itself, the possibility of transferring new air defense systems to Iran was discussed. Moreover, Iran sees the need for additional training from Russian specialists.

Shoigu, it should be noted, did not promise new supplies. I would like to believe that the military leadership has finally paid attention to the shortage of air defense systems in our own army.


7,601 posted on 10/26/2024 1:16:18 PM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 7594 | View Replies]

To: PIF; All

“The Israel Air Force struck a dozen targets in Iran that were used to produce solid fuel for long-range ballistic missiles as part of its retaliatory military action against the Islamic Republic, severely harming Tehran’s ability to replenish its inventory, Israeli media reported on Saturday night.

The targets struck were sophisticated equipment that Iran could not produce on its own and had to be purchased from China, Walla reported. The targets were a critical component of Iran’s ballistic missile program, Walla cited three anonymous Israeli sources as saying.

Israeli sources also stated that four S-300 air defense batteries were attacked that were in strategic locations that protected nuclear and energy facilities in Tehran during the operation. A factory for the production of drones and a facility in the Parchin military complex were also attacked, the latter of which saw in the past research and development activities for nuclear weapons.”


7,602 posted on 10/26/2024 1:47:17 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7601 | View Replies]

To: PIF; All

3500 BABY!

RuZzian Tanks (3505, of which destroyed: 2441, damaged: 158, abandoned: 375, captured: 531)


7,603 posted on 10/26/2024 1:51:35 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7602 | View Replies]

To: PIF; All

“Footage shows aftermath of Mi-2 helicopter crash in the Kirov region in Russia. All four people onboard died.”

https://x.com/NOELreports/status/1850225657701183783


7,604 posted on 10/26/2024 1:53:49 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7603 | View Replies]

To: PIF; All

I can’t wait for the body bags.

“By Monday, 5,000 North Korean soldiers will be deployed to Russia’s Kursk region, according to the New York Times. They are being flown from Vladivostok to a military airbase in western Russia and then moved to active combat zones.”

https://x.com/NOELreports/status/1850208944406290887


7,605 posted on 10/26/2024 1:55:57 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7604 | View Replies]

To: PIF; All

“Russian Telegram channels report a drone attack and a fire in the area of Ryazan oil refinery.

This oil refinery can process over 17 million tons of oil per year. It is the third most powerful oil refinery in Russia.”

https://x.com/Gerashchenko_en/status/1850216705647063062


7,606 posted on 10/26/2024 1:59:05 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7605 | View Replies]

To: PIF; All

“Russian visually-confirmed tank losses since the start of their 2022 invasion of Ukraine have exceeded 3 500!

T-54/55: 13
T-62: 207
T-64: 96
T-72: 1580
T-80: 990
T-90: 166
unknown tanks: 453


total: 3 505”


7,607 posted on 10/26/2024 2:01:08 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7606 | View Replies]

To: PIF

“Two more members of Iran’s army have died from injuries suffered during Israeli airstrikes earlier Saturday, according to state media, bringing the death toll to at least four.”


7,608 posted on 10/26/2024 2:54:37 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7607 | View Replies]

To: PIF

“Hours before the attack began, Israel alerted the U.S. and several Arab-world and European capitals about the nature and scope of the attack, according to people familiar with the matter. Officials in some of those countries then alerted Iran.”


7,609 posted on 10/26/2024 7:04:02 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7608 | View Replies]

To: SpeedyInTexas

Has Russia revived the Soviet bio weapons programs? Is that why they were blowing smoke about Ukrainian biolabs?

Kyiv Independent reports:

“Satellite imagery shows signs of a major renovation and expansion at a restricted military facility near Moscow that once housed a Cold War biological weapons program, the Washington Post (WP) reported on Oct. 25.

Sergiyev Posad-6, a military site northeast of Moscow, was a Soviet biological weapons research center during the Cold War. The Soviet military used the lab to experiment with weaponizing the viruses that cause smallpox and Ebola, among others.

Shortly after Russia launched its full-scale invasion of Ukraine in February 2022, satellite imagery indicated massive construction and renovation at the Sergiyev Posad-6 site, the WP reported, citing photos from imaging firms Planet Labs and Maxar. The expansion amounts to over 250,000 square feet and 10 new buildings.

According to experts in biodefense, the military, and satellite imaging who spoke to the WP, the facilities harbor some of the distinctive features of high-security biological labs that handle dangerous pathogens.

Among these features are extensive rooftop air handling units, underground infrastructure, heightened security, and a possible power plant. The layout is “consistent with lab design” and suggests “maximum containment” labs, one expert said.

“The upgrades are consistent with this secure, top-secret military biological facility’s historic role in developing viral biological weapons,” said Andrew Weber, a former Pentagon official and senior fellow at the Council on Strategic Risks.

Russian officials have said that the purpose of the labs is to study Ebola viruses and other deadly microbes in order to protect Russia from possible bioterrorism.

The expansion at Sergiyev Posad-6 coincides with a Russian disinformation campaign in the early months of the full-scale invasion, when the Kremlin falsely accused Ukraine of developing biological weapons.”


7,610 posted on 10/26/2024 7:11:15 PM PDT by BeauBo
[ Post Reply | Private Reply | To 7608 | View Replies]

To: SpeedyInTexas
Russia's Arctic-2 LNG Project is Dead on arrival.

OilPrice.com reports:

"Russia's Novatek recently halted operations at its Arctic LNG 2 project, and it has no plans to restart it this winter, according to an anonymous Reuters source familiar with the matter.

The development is a significant setback for the country's gas ambitions. This project, primarily located on the Gydan Peninsula in the Arctic and majority-owned by Novatek, was supposed to expand Russia's share in the global LNG market from 8% to an ambitious 20% by 2030. However, facing mounting sanctions from the U.S. and its allies due to the Ukraine conflict, Novatek has suspended its only active LNG train and currently has no plans to restart operations until next summer.

This suspension, which took effect on October 11, reflects the difficulties Arctic LNG 2 faces in finding buyers and securing the specialized ice-class vessels required for winter operations.

U.S. sanctions have made potential buyers wary of dealing with Russian LNG due to potential retaliatory consequences. In fact, U.S. Assistant Secretary for Energy Resources Geoffrey Pyatt emphasized that the U.S. is stepping up efforts to choke off Russia's revenue from LNG sales, citing this as part of a broader strategy to reduce funding for Moscow's military actions."

7,611 posted on 10/26/2024 7:18:31 PM PDT by BeauBo
[ Post Reply | Private Reply | To 7606 | View Replies]

To: PIF; All

“Israel’s attacks on Iran early Saturday destroyed air-defense systems set up to protect several critical oil and petrochemical refineries, as well as systems guarding a large gas field and a major port in southern Iran, according to three Iranian officials and three senior Israeli defense officials.

The sites targeted by Israel, according to the officials, included defenses at the sprawling Bandar Imam Khomeini petrochemical complex, in Khuzestan Province; at the major economic port Bandar Imam Khomeini, adjacent to it; and at the Abadan oil refinery. Air-defense systems were also struck in Ilam Province, at the refinery for the gas field, called Tange Bijar, said the officials, one of them with Iran’s oil ministry.

The Iranian and Israeli officials familiar with the attacks spoke on condition of anonymity to discuss intelligence.

Israel’s destruction of the air-defense systems has raised deep alarm in Iran, the three Iranian officials said, as critical energy and economic hubs are now vulnerable to future attacks if the cycle of retaliation between Iran and Israel continues.

“Israel is sending a clear message to us,” said Hamid Hosseini, an expert on Iran’s oil and gas industry and a member of the Iran-Iraq Chamber of Commerce. “This can have very serious economic consequences for Iran, and now that we understand the stakes we need to act wise and not continue the tensions.””


7,612 posted on 10/26/2024 9:16:15 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7611 | View Replies]

To: BeauBo

“Novatek recently halted operations at its Arctic LNG 2 project”

SCORE!

GOOOOOOOOAAAALLLL!


7,613 posted on 10/26/2024 9:17:39 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7611 | View Replies]

To: SpeedyInTexas

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Tactical Prowess: Ukrainian Counterattack Wipes Out Russian Gains ]


Today [ Oct 27 ], there are a lot of updates from the Kursk direction.

Here, the Russians used their tactical gains from previous attacks to expand their operations and attack Malaya Loknya. However, the Russian forces advanced way too narrowly, exposing their weak spots and giving the Ukrainians a chance to make a decisive move.

After consolidating control over Zeleni Shlyakh and Liubimovka, the Russians leveraged stable logistics, utilizing paved roads to amass forces at the strategic intersection of Zeleni Shlyakh. This allowed them to extend their advance toward Malaya Lokhnya via a direct assault.

The plan involved a rapid push along the 7-kilometer road, using BTR-82 armored personnel carriers to cover the distance in just five minutes. Once in position, Russian stormtroopers would dismount and engage in close combat to seize control of the outskirts of the village. If successful, this maneuver would encircle Ukrainian forces in Pogrebki, north of Malaya Lokhnya, cutting them off and trapping them in a pocket.

Combat footage reveals that the Russians launched their assault with 3 BTR-82 vehicles carrying a platoon of stormtroopers along the road to Malaya Lokhnya. However, the first BTR was quickly neutralized by an FPV drone strike, followed by the destruction of the second vehicle, wiping out two-thirds of the assault unit within seconds.

Simultaneously, the Ukrainians positioned a T-64BV tank on the road, which engaged and eliminated the final BTR, effectively neutralizing the remaining Russian stormtroopers and halting the assault.

In the end, the Russian assault was halted and destroyed just 1.5 kilometers from the outskirts of Malaya Lokhnya, with any survivors retreating to their starting point. Now aware of the Russian plan, the Ukrainians decided to launch decisive strikes and counterattacks at the staging ground in Zeleni Shlyakh.

By concentrating their efforts in this area, the Ukrainians aimed to prevent the Russians from massing additional forces for further assaults. This strategy would neutralize the earlier Russian gains, rendering their offensive momentum ineffective.

Ukrainian marines from the 36th Marine Brigade deployed six armored vehicles in a counterattack against Russian forces south of Zeleni Shlyakh. In the assault, they successfully destroyed several Russian vehicles, forcing the enemy infantry to retreat on foot under heavy fire from cluster munitions and FPV drone strikes.

Unaware of the Ukrainian presence, the Russians had deployed a column to attack south of Zeleni Shlyakh, only to be ambushed and destroyed by the Ukrainian assault group. The surviving Russian forces were forced to crawl to safety and take cover as Ukrainian tanks suppressed their main positions along the tree lines near the town.

This allowed the Ukrainian infantry to dismount and secure the area. Ultimately, the Ukrainian marines pushed the Russians back by more than 2 kilometers, positioning themselves just outside Zeleni Shlyakh and preventing the Russians from massing forces for further assaults.

To capitalize on Russian vulnerabilities in the area and weaken their operational base, Ukrainian command deployed the elite 47th Mechanized Brigade to dislodge Russian forces from Novoivanivka, utilizing Bradley infantry fighting vehicles and Abrams tanks.

Combat footage shows the Bradleys effectively suppressing Russian infantry positions in the tree lines, while the Abrams tanks targeted and destroyed fortified positions in houses used by Russian troops for firing.

The lack of retaliatory fire from the Russians suggests they were overwhelmed and rendered combat ineffective due to high losses. This allowed Ukrainian infantry to secure the area. As a result, the Ukrainians advanced another kilometer, fully recapturing Novoivanivka and intensifying pressure on Russian forces concentrated in Zeleni Shlyakh.

Overall, the failure of the Russian attack at Malaya Lokhnya revealed their plans of operation, leading to several Ukrainian counterattacks and their suppression of the Russian tactical bridgehead at Zeleni Shlyakh, preventing any further Russian attacks.

The Russian failure in this area destroyed their hope for a Blitzkrieg victory in Kursk with Chechen commander of Ahmad forces in the area AB Alov Colonate the most difficult part of the front.

This led to the Kremlin postponing their plans of operation in Kursk, postponing the deadline to push the Ukrainian forces out of Kursk from the 15th of October to the 1st of February.


7,614 posted on 10/27/2024 4:46:42 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 7613 | View Replies]

To: PIF

Trumps metaphor on Rogan as he was weaving: Russia is just a grinding war machine. You don’t have to like it, it just is.


7,615 posted on 10/27/2024 5:16:52 AM PDT by Kudsman (Hey, Democrat, leave those kids alone!)
[ Post Reply | Private Reply | To 7614 | View Replies]

To: SpeedyInTexas

Kremlin snuff box, 10/27/24
https://t.me/s/kremlin_secrets

Putin named the date by which the DPR must be liberated and joked about Georgia

Vladimir Putin wants the DPR to be completely liberated from the Ukrainian army by March 1, 202. The president gave this order to the military, our sources in the Kremlin and the Ministry of Defense said.

“The President spoke briefly with the military on Sunday. He was in a good mood, he was pleased with the results of the Georgian elections. Vladimir Vladimirovich even joked: he hopes that we will not have to conduct a military training exercise in Georgia. He also set clear tasks for the military,” said one of the channel’s interlocutors.

Putin wants ( in particular, taking into account the successful actions of our army in the Selidovo area and a number of other settlements ) for the entire territory of the DPR to be liberated by March next year.

However, not all military personnel believe that such a date is realistic; some believe that the battles for Donbass will last most of next year. The President noted that “delaying hostilities is extremely undesirable.”

At the same time, Vladimir Vladimirovich did not give a clear order regarding the date of liberation of the Kursk region. “The military convinced the president that the situation there was very unpredictable. And it’s impossible to talk about any clear deadlines now,” a source in the Ministry of Defense explained to us.


7,616 posted on 10/27/2024 6:38:24 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 7613 | View Replies]

Russian Offensive Campaign Assessment, October 26, 2024

Bloomberg reported on October 25, citing South Korean intelligence documents, that a second group of North Korean soldiers will soon deploy to Russia. Bloomberg reported that it viewed South Korean intelligence documents from an unspecified date that assessed that the first group of 1,500 North Korean “elite special forces” had arrived in Vladivostok, Primorsky Krai between October 8 and 13 and that this first group was part of a planned deployment of roughly 10,000 North Korean soldiers in total.[1] Bloomberg also reported that the documents assessed that North Korea has sent roughly 8 million rounds of 122mm and 152mm shells to Russia since August 2023, roughly 100 KN-23 Hwasong-11 ballistic missiles, and an unspecified number of Bulsae-4 anti-tank weapons. Bloomberg, citing two people familiar with the matter, stated that South Korean officials will share South Korea's assessments about North Korean-Russian cooperation with NATO officials at an October 28 NATO meeting. The New York Times (NYT), citing one unnamed Ukrainian official and two unnamed US officials, reported on October 25 that “several thousand” North Korean soldiers arrived at Kursk Oblast to participate in an upcoming Russian counteroffensive operation to push Ukrainian forces from their salient in Kursk Oblast.[2] The officials stated that North Korean forces have not engaged in combat operations yet and that the North Korean forces’ task in Kursk oblast is unclear. The officials noted that a significant contingent of North Korean forces would help the Russian military to avoid pulling additional forces from eastern Ukraine to participate in counteroffensive operations in Kursk Oblast. A senior Ukrainian official told the NYT that a maximum number of 5,000 elite North Korean troops had likely arrived in Russia by October 21.[3] The participation of North Korean troops in combat operations in Kursk Oblast or frontline areas in Ukraine would make North Korea an active combatant and belligerent in Russia's invasion of Ukraine.

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-october-26-2024

7,617 posted on 10/27/2024 6:53:50 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 7588 | View Replies]

Russian losses last week were 10 520 = 1050/7/24/60 = 1.04, i.e. more than 1 per minute


7,618 posted on 10/27/2024 7:09:02 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 7590 | View Replies]

To: PIF; All

When does it all come crashing down?

“Russian economy overheating, but still powering the war against Ukraine”

“In Siberia, there are not enough men to drive the buses. On Russian farms, milkmaids are commanding wages similar to those of IT workers, while hotels struggle to hire waiters, cleaners and cooks.

Instead of cratering as had been widely predicted with the Western sanctions regime after Russia’s full-scale invasion of Ukraine in 2022, the Russian economy is running hot and in danger of overheating.

Massive military spending including high payments to soldiers has fueled economic growth, as well as high wages and inflation, as companies are forced to match military salaries to attract workers.”

https://archive.ph/MBKAB


7,619 posted on 10/27/2024 7:12:25 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7616 | View Replies]

To: PIF; All

More likely 30,000 per month.

“The economy is overheating partly because of President Vladimir Putin’s need to replace the 20,000 soldiers killed or wounded monthly, according to losses reported by the Institute for the Study of War in June. Russian regional governors are paying unheard of sign-up bonuses to attract soldiers, with Belgorod recently breaking the record with a $31,200 bonus.”


7,620 posted on 10/27/2024 7:13:48 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7619 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 7,581-7,6007,601-7,6207,621-7,640 ... 21,001-21,009 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson