Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 7,001-7,0207,021-7,0407,041-7,060 ... 21,361-21,363 next last
To: PIF

“Starship’s fifth flight test is preparing to launch as soon as October 13, pending regulatory approval”

“SpaceX says it will attempt to catch the Starship Super Heavy booster with the pad chopsticks, but it would “require healthy systems on the booster and tower and a manual command from the mission’s Flight Director. If this command is not sent prior to the completion of the boostback burn, or if automated health checks show unacceptable conditions with Super Heavy or the tower, the booster will default to a trajectory that takes it to a landing burn and soft splashdown in the Gulf of Mexico.””

https://x.com/wapodavenport/status/1843464950871724368


7,021 posted on 10/08/2024 8:10:42 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7018 | View Replies]

To: FtrPilot

“New equipment”

Lets suppose the war doesn’t end ‘24 hours after the election’. I know, I’m being wildy crazy in my thinking...

Ukraine will likely need to rely on Europe instead of the US for weapons. Can/Will Europe meet the challenge?

Congress might pass one more aid package during the lame duck session after the election.

The Free World may be facing dark days ahead.


7,022 posted on 10/08/2024 8:17:09 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7020 | View Replies]

To: PIF; All

“Russia is on a ‘sustained mission’ to create mayhem on Europe’s streets, UK spy chief says”

“The head of Britain’s domestic spy agency on Tuesday accused Russian military intelligence of being on a “sustained mission” to cause mayhem in Britain and Europe.

In a rare public speech from MI5′s counter-terrorism operations center in London, MI5 Director General Ken McCallum said ongoing efforts by autocratic states to harm Britain’s security represents “the most complex threat environment we have ever seen.”

McCallum said a total of 43 late-stage attack plots had been foiled by MI5 and police since 2017, noting that some plotters were seeking to get hold of firearms and explosives “in the final days of planning mass murder.””

https://www.cnbc.com/2024/10/08/russia-on-a-mission-to-create-mayhem-on-european-streets-mi5-says.html


7,023 posted on 10/08/2024 8:19:19 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7022 | View Replies]

To: SpeedyInTexas
I believe that President Trump will not "immediately" stop shipment of weapons & equipment that are in the pipeline. He may put restrictions on them, but he won't stop them.

"Can/Will Europe meet the challenge?"

I do believe that Europe will continue to support Ukraine.

The question I have is: Would President Trump use ITAR to inhibit Europe's ability to support Ukraine?

7,024 posted on 10/08/2024 8:29:49 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 7022 | View Replies]

To: SpeedyInTexas

Starship’s fifth flight test is preparing to launch as soon as October 13, pending regulatory approval

An Oct 13 launch would be without a license from the FAA, which is not expected to issue one until late Nov. However, if they skip the catching maneuver, and repurpose it as Flight 4A, then they can launch as long as the mission remains the same as Flight 4 since that mission is already licensed.

The delay is caused by various local wacko environmental groups who issue silly complaints to the FAA, but the FAA has to investigate each of them, no matter how ridiculous. Musk’s lawsuit against the FAA does not help either.


7,025 posted on 10/08/2024 9:15:04 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 7021 | View Replies]

To: PIF; All

The same as it ever was

Russia - 18316, of which: destroyed: 13511, damaged: 807, abandoned: 1022, captured: 297

Tanks (3446, of which destroyed: 2386, damaged: 158, abandoned: 370, captured: 532)

https://www.oryxspioenkop.com/2022/02/attack-on-europe-documenting-equipment.html


7,026 posted on 10/08/2024 11:19:58 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7025 | View Replies]

To: SpeedyInTexas

Feodosia is still burning.


7,027 posted on 10/08/2024 11:46:49 AM PDT by marcusmaximus
[ Post Reply | Private Reply | To 7018 | View Replies]

To: marcusmaximus; PIF
Fire at Russia's Feodosia oil terminal in occupied #Crimea going from bad to worse.

Now 2nd day since #Ukraine struck it & they're still unable to extinguish the fires.

Video shows situation out of control, with several new oil tanks burning.

https://x.com/GlasnostGone/status/1843714575335862647


7,028 posted on 10/08/2024 12:41:09 PM PDT by FtrPilot
[ Post Reply | Private Reply | To 7027 | View Replies]

To: SpeedyInTexas
“The worst crisis in 30 years”: Russia's coal mining industry begins to collapse.

The Russian coal industry, one of the largest raw materials industries in the economy, comprising more than 30 single-industry towns and hundreds of thousands of employees, is hurtling towards a severe crisis. Having lost Western markets, faced with a sharp drop in demand in “friendly” countries and multi-billion dollar losses, coal companies have begun to sharply cut production.

According to Rosstat , coal production in Russia fell by 6.7% year-on-year in July, and its total volume of 31.5 million tons was the lowest since the 2020 pandemic. Compared to the peaks shown in December 2022, coal companies have lost about 12 million tons of monthly production, or 27%. The production of hard coal, the main product of coal miners, which accounts for 80% of production, has collapsed by 8.2%, and anthracite, the most valuable grade, by almost a quarter (by 23.7%). In August, according to operational statistics from Rosstat , the decline in coal production accelerated to 10.1% year-on-year.

Supplies to China in the first half of 2024 fell by 8% and are not expected to grow, complained Russian Energy Minister Sergei Tsivilev in September. The fact is that Beijing has imposed duties on Russian coal, the minister explained. At the same time, other suppliers - Indonesia and Australia - were not affected by them, since they are part of a free trade zone with China. India has cut its coal imports from Russia by 55%, and Turkey by 47%, according to CREA estimates. Russia's total coal exports fell by 11.4% in January-July, to 112.6 million tons. And since coal miners exported about half of their output, the blow was painful for them, Kluge notes.

As a result: according to Rosstat, more than half of coal companies became unprofitable, and the net financial result of the entire industry became negative. The total loss of the coal industry for January-July amounted to 7.1 billion rubles. At the same time, the losses of unprofitable companies increased by 3.4 times, and the profit of profitable ones decreased by 72%.

https://www.moscowtimes.ru/2024/10/07/samii-tyazhelii-krizis-za30-let-vrossii-nachala-rushitsya-dobicha-uglya-a144209

7,029 posted on 10/08/2024 3:08:55 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 7026 | View Replies]

To: FtrPilot

Another satisfying day in America!


7,030 posted on 10/08/2024 3:10:36 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7028 | View Replies]

To: PIF; All

“High-quality satellite images obtained by Radio Svoboda show the fire at the oil facility in Feodosia. As of this evening, it looks like at least 10 fuel tanks were engulfed in flames. Witnesses later reported that the fire spread to other tanks, with some exploding.”

https://x.com/NOELreports/status/1843755217852215371


7,031 posted on 10/08/2024 3:19:33 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7030 | View Replies]

To: PIF; All

“U.S. intel officials tell reporters that Moscow is “leveraging a wide range of influence actors in an effort to influence congressional races, particularly to encourage the U.S. public to oppose pro-Ukraine policies and politicians””

https://x.com/ralakbar/status/1843700803892297746


7,032 posted on 10/08/2024 3:23:48 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7031 | View Replies]

To: PIF; All

Smack the Drone

https://x.com/GloOouD/status/1843661350251397589


7,033 posted on 10/08/2024 3:28:12 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7032 | View Replies]

To: PIF; All

“A US visit by Israel’s defense chief — billed as a chance for the allies to craft a common strategy in a face-off against Iran — has been postponed, a Pentagon spokesperson said Tuesday.

An Israeli official, who asked not to be identified discussing the decision, cited last-minute objections to the trip by Prime Minister Benjamin Netanyahu.

Defense Minister Yoav Gallant, who has sparred with Netanyahu about the conduct of the yearlong war in Gaza and on other fronts, had been due to fly to Washington for talks on Wednesday about “ongoing Middle East security developments,” the Pentagon had announced.”


7,034 posted on 10/08/2024 3:33:29 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7033 | View Replies]

To: AdmSmith

“The worst crisis in 30 years”

…so far.


7,035 posted on 10/08/2024 8:40:09 PM PDT by BeauBo
[ Post Reply | Private Reply | To 7029 | View Replies]

To: BeauBo

Every day a BATTALION of deserters in the Ukranian army!

Interesting figures on desertion from the Armed Forces of Ukraine are published by Ukrainian journalists.

January - April 2024:
- 19,000 people deserted from the army
- 4,750 per month
- approximately 160 per… That makes a BATTALION of deserts from the Ukrainian Armed Forces every day!!! The number is only growing, especially with und forced recruitment from the steers.
And these are not rear-echelon soldiers, these are those at the front.
This is the kind of "c'est la vie". That is why they started talking about mobilizing 20-year-olds. There is no other way to save the situation.
Most important - we are talking only about officially registered cases of desertion.
In reality there are much more.

pic.twitter.com/fojvljv6Lu— Lord Bebo (@MyLordBebo) October 9, 2024


7,036 posted on 10/09/2024 2:58:15 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 7035 | View Replies]

To: SpeedyInTexas

The usuals tell us that only the Ukrainians have the elderly fighting in the front. Then again he could be in his thirties and lots of potato water drank


7,037 posted on 10/09/2024 4:14:21 AM PDT by blitz128
[ Post Reply | Private Reply | To 7033 | View Replies]

To: SpeedyInTexas

Amazing what “falling debris” can accomplish 😎


7,038 posted on 10/09/2024 4:15:58 AM PDT by blitz128
[ Post Reply | Private Reply | To 7031 | View Replies]

To: SpeedyInTexas

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Russian Losses Mount at Vuhledar as Ukrainians Escape Through an Open Corridor ]


Today [ Oct 09 ], the biggest developments come from the Vuhledar direction.

Here, Russians tried desperately to fully close their encirclement and capture the entire Ukrainian contingent in Vuhledar, but were forced to engage in intense urban fighting and go through the town instead of around it. Ukrainians also set up a new line of defense, leaving Russians to be stuck in the soon-to-arrive autumn mud after having won a bitter victory.

As Russians had crossed the river from the west and advanced on Vuhledar’s eastern flanks from Vodiane, Russians were close to taking the town into complete encirclement, trapping Ukrainian forces inside. Russians were targeting the only Ukrainian supply lines into the city with drones and artillery strikes as well, severely deteriorating the situation for Ukrainian defenders.

The only options left for Ukrainians were either to push Russians out of Vuhledar’s flanks and reestablish ground lines of communication with the town, or for the Ukrainian 72nd Mechanized Brigade to conduct a withdrawal.

Pushing Russian forces out of their attempted encirclement of Vuhledar was a significant challenge for Ukraine. The Ukrainian brigades on Vuhledar’s flanks were largely unmechanized, lacking the necessary firepower to launch a direct assault on Russian positions. Western weapon deliveries were limited and needed to be prioritized for other areas of the front, and Ukraine couldn’t divert mechanized units from those sectors to reinforce Vuhledar.

Ukrainian soldiers reported that Russian Spetsnaz special forces and specialized drone units were supporting the infantry assaults on Vuhledar, attacking from three sides and maintaining constant artillery fire. With compromised supply lines and increasing pressure, the Ukrainians’ only option was to withdraw from the town. They prioritized saving the veteran 72nd Mechanized Brigade over holding Vuhledar, which had already been reduced to ruins.

The Ukrainian rifle brigades and battalions on the flanks, skilled in defensive operations, were assigned to hold the line against Russian forces attempting to fully encircle Vuhledar. If we look at the topographic map, we can see that the Russians had to cross multiple gullies, lowlands, and rivers to complete the encirclement.

Meanwhile, the Ukrainians held the high ground on the opposing hill ridges, giving them an advantage in repelling Russian attacks. They also maintained control over the western part of Coal Mine Number 3 to prevent the Russians from advancing along the ridge toward Bohoiavlenka, which would have jeopardized the rescue operation.

Ukrainians released numerous videos showing their successful defense against Russian mechanized attacks on Vuhledar’s eastern flanks, where they destroyed many Russian infantry fighting vehicles using FPV drones. One video showed a Russian BMP-2 infantry fighting vehicle attempting to assault Ukrainian positions on the western flank.

Ukrainian forces responded with their own BMP-2, opening fire and killing the Russian crew. The footage concludes with Ukrainian soldiers capturing the Russian vehicle and driving it back to their lines, waving a Ukrainian flag, to avoid being mistaken for the enemy.

As Ukrainians retreated from Vuhledar, Russian drone footage showed them targeting Ukrainian vehicles used in the evacuation. However, most strikes were on stationary targets, suggesting Ukrainian troops had already evacuated into the tree lines. When the footage showed strikes on moving Ukrainian vehicles, it pixelated and cut out before impact, indicating Ukrainians were using electronic warfare to disrupt Russian drone attacks.

Russians also targeted Ukrainian evacuation routes with nighttime artillery barrages, attempting to hit troops moving undetected through the tree lines. Despite these efforts, Russians were unable to fully encircle Vuhledar, due to strong Ukrainian resistance on the flanks, and the logistical challenge of having their nearest supply hubs 18 to 30 kilometers away, with no hardened roads for easier access.

By October 1st, it was evident that Ukrainian forces had completed their withdrawal from Vuhledar. Russians quickly moved in posting numerous videos of raising Russian and Soviet flags on the town’s buildings.

In response the Ukrainian 72nd Mechanized Brigade, which had defended Vuhledar for nearly 2 years, addressed the Russian 155th Naval Infantry Brigade which had been reconstituted over 8 times due to severe losses in repeated assaults on Vuhledar.

The Ukrainian brigade then released a 3-part video series showing how they continued to repel the Russian brigades frontal assaults even as they organized their own retreat diminishing the Russian Victory. At the time many Russian analysts were skeptical that capturing Vuhledar would lead to a larger operational breakthrough or cause Ukrainian defenses to collapse.

Ukrainian forces had a solid defensive line behind Vuhledar, positioned between Novoukrankia and Bohoyanainka, which provided similar geographic advantages that had made Vuhledar a stronghold.

Additionally, only dirt roads and fields intersected by Gulis rivers and lowlands lead toward the next Ukrainian defensive line. These areas would soon turn into muddy terain with the coming rainy season complicating any Russian advances. With the Ukrainians holding the high ground Russians would face significant challenges moving through the lowlands and mud.

The Institute For The Study of War also pointed out that it would take time for Russians to fully clear and repurpose Vuhledar as a supply hub, meaning that for now Russians would have to rely on overstretched supply lines.

In the end, the battle for Vuhledar did not result in the decisive breakthrough for Russian forces they had likely hoped for, despite their efforts to fully encircle and capture the town. Ukrainian troops executed a strategic withdrawal, prioritizing the survival of their forces over holding ground already devastated by combat.

While the Russians claimed victory in the end raising their flags over Vuhledar, the cost to them was immense. Russian brigades like the 155th Naval Infantry suffered severe losses, having to be reconstituted multiple times over over the course of many failed attempts to take the city in the last 2 years.

Meanwhile, Ukrainian defenses remain strong further in the west with new defense lines positioned on high ground, giving them a continued advantage, as the terrain will become increasingly difficult to cross with the approaching autumn rains.

Finally, the 72nd Mechanized Brigade themselves stated that while the line of defense has changed, the work has not, as they continue to share a footage of them repulsing Russian attempts to advance toward the next line of defense.


7,039 posted on 10/09/2024 5:18:12 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 7034 | View Replies]

To: PIF

“the Russian 155th Naval Infantry Brigade which had been reconstituted over 8 times due to severe losses in repeated assaults on Vuhledar.”

Wow. What an obscene meatgrinder of human beings Putin has created. Satan must be thrilled with him.


7,040 posted on 10/09/2024 6:22:42 AM PDT by BeauBo
[ Post Reply | Private Reply | To 7039 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 7,001-7,0207,021-7,0407,041-7,060 ... 21,361-21,363 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson