Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: agitprop; attackoneurope; bidenswar; bobomaximus; cheesymaximus; dailydeathfap; dailypropaganda; deathcult; dualcitizenssuck; escalation; fishiemaximus; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; hopium; liberalatpost7819; nato; oyveygoyim; pancakemaximus; phdft; propagandareturns; put; putin; russia; siloviki; snufffilmsonfr; snufffilmtx; snuffyfromtexas; spammyintexas; speedomaximus; stankazztexicunt; stenrynning; talkingtomypif; ukraine; unhealthyobsession; warporn; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath
Navigation: use the links below to view more comments.
first previous 1-20 ... 6,881-6,9006,901-6,9206,921-6,940 ... 8,101-8,108 next last
To: PIF; All

droned

https://x.com/GloOouD/status/1841891905010893156


6,901 posted on 10/04/2024 8:25:19 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6900 | View Replies]

To: PIF; All

Bay of Pigs, I tell ya!

“Hunting for Russo-logistics in Kursk Oblast.”

https://x.com/Heroiam_Slava/status/1842157272505495885


6,902 posted on 10/04/2024 8:27:58 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6900 | View Replies]

To: PIF; All

“In the Kursk region from Magyar birds”

https://x.com/Heroiam_Slava/status/1842149112390521201


6,903 posted on 10/04/2024 8:29:01 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6902 | View Replies]

To: SpeedyInTexas; BeauBo
⚡️ Russian gas giant Gazprom was ranked as the most unprofitable company in Russia last year, ending 2023 with a record net loss of $6.1 billion, Forbes Russia reported on Oct. 3.

https://x.com/KyivIndependent/status/1841879905895657988

This is why ruzzia has stopped reporting on their petroleum industry.

6,904 posted on 10/04/2024 9:30:44 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 6903 | View Replies]

Russian Offensive Campaign Assessment, October 4, 2024

Senior Russian officials continue to promote contract service in the Russian military, likely as part of ongoing crypto-mobilization efforts. Russian Security Council Deputy Chairperson Dmitry Medvedev stated on October 3 that Russian military contract service is “the only way to attract” Russians to participate in the war in Ukraine.[40] Medvedev’s statement is likely also an attempt to assuage concerns among the Russian domestic population about another potential wave of partial mobilization.

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-october-4-2024


6,905 posted on 10/05/2024 1:41:46 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6889 | View Replies]


6,906 posted on 10/05/2024 1:43:22 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6855 | View Replies]

72 Artillery systems


6,907 posted on 10/05/2024 1:45:10 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6890 | View Replies]

To: FtrPilot

“Russian gas giant Gazprom was ranked as the most unprofitable company in Russia last year”

Putin did that. His leadership has produced some truly epic outcomes, in destroying Russia’s wealth, strength, prestige and influence..

Gazprom got hit with some huge one time write offs, like the loss of their European subsidiaries and Nordstream. Also, they had to pay some big judgements for breaching contracts, to serve as Putin’s energy weapon, in his failed attempt to coerce Europe by throttling gas supplies before the Winter of 22.

Gazprom can still operate profitably on some significant projects, and in their domestic market (at a significantly reduced level long term), but some of their major projects for the future also seem to be casualties of Putin’s disastrous reign, like the Power of Siberia 2 pipeline, and the Arctic 2 LNG project (previously Russia’s biggest natural gas deals for future expansion, now imploding).


6,908 posted on 10/05/2024 2:29:52 AM PDT by BeauBo
[ Post Reply | Private Reply | To 6904 | View Replies]

To: BeauBo

Half of Russia’s shells used in Ukraine supplied by North Korea. https://freerepublic.com/focus/news/3328416/posts?page=24#24


6,909 posted on 10/05/2024 4:15:25 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6908 | View Replies]

To: BeauBo

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Tanks Unleashed! Ukrainians Cut Off Russian Bridgehead! ]


Today [ Oct 05 ], there are a lot of updates from the Svatove direction.

Here, amid mounting pressure from powerful Russian assaults threatening a breakthrough from their strategic bridgehead on the Zherebyets River, Ukrainian command responded with a bold move. The elite 3rd Assault Brigade was deployed, setting the stage for a crucial counterattack to stabilize the defense line against a larger force.

The Russian objective in this part of the front is to gain full control over the remaining areas of the Luhansk region, and use the bridgeheads near Makiivka to launch assaults on the northern Donetsk region. The heavy concentration of Russian forces, combined with months of continuous attacks, has greatly strained the Ukrainian defense efforts.

The Ukrainian command initiated a series of counterattacks using the 3rd Assault Brigade north of Makiivka, aiming to sever one of the key Russian supply routes to the town. This strategy forced the Russians to shift their focus from consolidating their bridgehead at Makiivka, giving Ukrainian forces the opportunity to fortify their defenses before the Russians resume their assaults.

The 3rd Assault Brigade is one of the most elite units of the Ukrainian army. The organization of this brigade was strategically designed to create a highly mobile, well-equipped, and extensively trained force capable of engaging in offensive and active defensive operations alike.

The Ukrainians began their operation by deploying thermite flamethrower drones to burn down tree lines surrounding Russian dugouts and trenches. By eliminating this cover, they significantly improved visibility for operators of standard FPV drones, making it easier to detect larger groups of Russian troops.

As the tree lines were set ablaze, Ukrainian drone operators were able to target and eliminate more Russian soldiers. Even when drones missed their mark and hit nearby trees or branches, the resulting shrapnel still wounded or killed nearby Russian forces.

The deployed drones also relayed information about Russian positions to artillery and mortar operators of Ukrainian artillery groups. The artillery groups of the 3rd Assault Brigade are equipped with modern British AS-90 self-propelled artillery whose artillery shots were accurate to the point that Russian troops got destroyed even while moving.

After heavy artillery and drone strikes weakened Russian positions and destroyed a significant portion of their defenses, the fighters of the 3rd Assault Brigade launched ground assaults. T-64-BV tanks advanced toward Russian positions to target areas that hadn’t been fully neutralized by artillery and drones. Once their objectives were achieved, the tanks deployed smoke grenades to cover their retreat and withdrew from the battlefield.

With most of the Russian defenses destroyed, Ukrainian stormtroopers were deployed in M113 armored personnel carriers. Upon dismounting, they launched a coordinated sweep of the Russian positions. Many Russian soldiers, already disoriented from the earlier shelling and drone strikes, had taken cover in their dugouts.

However, unfortunately for the Russians, the Ukrainian stormtroopers quickly engaged and eliminated those that remained. In the end, only one Russian soldier surrendered, providing critical intelligence on nearby Russian units. He was the sole survivor of the assault, as all others were killed in action.

Interestingly, despite being outnumbered 2 to 1, the Ukrainians secured new positions through the well-coordinated efforts of their units. These assaults north of Makiivka forced the Russians to divert their forces to the northern flank in an attempt to stabilize the situation.

Although the Russians have launched counterattacks to reclaim the lost positions, the 3rd Assault Brigade continues to hold the line by utilizing continuous active defense approach.

Overall, the Ukrainians managed to delay the Russian months-long infantry-intensive assaults on Makiivka and bought the Ukrainian forces near the town enough time to fortify the west bank of the river, before the Russians engaged.

Ukrainian stormtroopers managed to shift focus of the Russians, which forced them to redirect a portion of their forces to counterattack lost positions to no avail. Such continuation of Ukrainian operations can enable them to uppercut the Russian Makiivka bridgehead from the north, by assaulting Novovodiane and forcing Russia to withdraw from Makiivka, as Ukrainians are now in a better position to exert fire control over the lowlands along the river.


6,910 posted on 10/05/2024 5:06:11 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 6908 | View Replies]

To: PIF; marcusmaximus; SpeedyInTexas
✈️💥A brief description of the entire incident with the crash of the Russian aircraft in one post:

About two hours ago, reports began to appear in both Ukrainian and Russian sources about the downing of an aircraft in the Konstantynivka area, Donetsk front.

Almost immediately after this, in a short time, a number of photos and videos from the site of the wreckage followed. According to the published material, it became clear that this was a Russian aircraft that crashed on territory controlled by Ukraine.

However, at first, an erroneous conclusion was made that the wreckage belonged to a Su-25. A small detail that some immediately noticed was an atypical camouflage pattern that had not previously been seen on Russian Su-25s.

Then followed the publication of a number of videos by various sources showing that the aircraft was shot down by friendly Russian fire from another aircraft, as well as videos of the wreckage falling to the ground. The shape of the falling wreckage did not match the shape of the Su-25 fuselage.

As a result, with the publication of even more material and clearer photos of the wreckage, it was finally established that the downed aircraft was a Russian Sukhoi S-70 Okhotnik-B stealth heavy unmanned combat aerial vehicle (UCAV).

🧵More videos and photos of the crash site, moment of friendly fire incident and falling debris available in attached thread

https://x.com/bayraktar_1love/status/1842521933599883414

Friendly fire?

6,911 posted on 10/05/2024 6:34:28 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 6910 | View Replies]

To: FtrPilot

Su-70 drone?


6,912 posted on 10/05/2024 6:40:09 AM PDT by BeauBo
[ Post Reply | Private Reply | To 6911 | View Replies]

To: FtrPilot

Likely there are very few of those things.


6,913 posted on 10/05/2024 6:40:45 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 6911 | View Replies]

To: BeauBo

They’ve been testing them for some time - usually escorted.


6,914 posted on 10/05/2024 6:42:02 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 6912 | View Replies]

To: FtrPilot

Clearer Picture Of Damage To Israeli Airbase From Iranian Ballistic Missiles Emerges
Dozens of impact areas have been identified within Israel’s Nevatim Airbase but few Iranian ballistic missiles appear to have hit their targets.
https://www.twz.com/air/clearer-picture-of-damage-to-israeli-airbase-from-iranian-ballistic-missiles-emerges


Ukraine Now Using Dragon Drones To Burn Russian Bunkers, Tanks
Initially used to attack Russians hiding in treelines and trenches, Ukraine’s thermite-spewing Dragon drones are taking on new targets.
https://www.twz.com/news-features/ukraine-now-using-dragon-drones-to-burn-russian-bunkers-tanks


How The Navy’s New Very Long-Range AIM-174 Missile Could Pierce China’s Anti-Access Bubble
The AIM-174 is a beast of an air-to-air weapon, but how could it actually be used to maximum effect in a Pacific fight?
https://www.twz.com/air/how-the-aim-174-could-pop-chinas-anti-access-bubble-in-the-pacific


First Plutonium Pit For Nuclear Warhead Produced In The U.S. In 35 Years Is Now “Weapon-Ready”
Production of plutonium pits is one step in a long process to produce the new W87-1 thermonuclear warhead for the future Sentinel ICBM.
https://www.twz.com/nuclear/first-plutonium-pit-for-nuclear-warhead-produced-in-the-u-s-in-35-years-is-now-weapon-ready


6,915 posted on 10/05/2024 6:45:58 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 6904 | View Replies]

To: PIF; BeauBo
Spectacular footage of a jet downing a Russian S-70 "Okhotnik".

There are currently conflicting reports regarding the shooting plane. In one instance it is claimed to be an Ukrainian jet, others claim it was a Russian plane, shooting down the malfunctioning UAV so that it does not fall in Ukrainians hands. If the latter happened, then it partially failed, because the remains of UAV landed on Ukrainian-controlled soil.

The cost of one unit is around $15-18 million.

https://x.com/Tendar/status/1842527606953873639

"...others claim it was a Russian plane, shooting down the malfunctioning UAV so that it does not fall in Ukrainians hands."

This is what I believe...the ruzzians lost control of the UAV, so they shot it down.

The only question I would have is: Did UKF EW cause the ruzzians to lose control of the UAV?

6,916 posted on 10/05/2024 6:54:01 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 6915 | View Replies]

To: AdmSmith

“Half of Russia’s shells used in Ukraine supplied by North Korea”

I doubt that is because North Korea is out producing Russia. North Korea is likely burning through their huge war stocks of Artillery shells - demilitarizing themselves in the process, and changing the calculus of a potential Inter-Korean conflict.

Besides short term cash, the reasons I see that they might want to do that, could be to get a credible nuclear weapons capability to replace their Artillery capability, or possibly to leverage Russia to wriggle out from under China’s control.


6,917 posted on 10/05/2024 6:58:42 AM PDT by BeauBo
[ Post Reply | Private Reply | To 6909 | View Replies]

To: FtrPilot

2 min video of the Sukhoi S-70 Okhotnik-B
https://www.youtube.com/watch?v=9xFYc3KCbHw

https://en.wikipedia.org/wiki/Sukhoi_S-70_Okhotnik-B


6,918 posted on 10/05/2024 7:08:43 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6916 | View Replies]

To: BeauBo
29JUL2024 Several factories in North Korea have altered their production processes to quickly churn out 152-millimeter artillery shells, officials in the country told Radio Free Asia, but they do not know whether the ammunition is going to Russia for use in its war with Ukraine.

“Key officials at the factory do not know whether the 152 mm artillery shells produced here are intended to support Russia,” an official at a factory in the northern province of Ryanggang told RFA Korean on condition of anonymity for security reasons.

“However, considering the production process was urgently prepared immediately after Kim Jong Un’s visit to Russia, it is assumed that it is for the purpose of supporting Russia,” he added.

North Korean leader Kim Jong Un inspects a military factory in August 2024.

https://www.rfa.org/english/news/korea/north-korea-munitions-production-ukraine-russia-07292024131858.html

6,919 posted on 10/05/2024 7:15:52 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6917 | View Replies]

To: AdmSmith
Here's a side view picture of the Sukhoi S-70 Okhotnik-B:

Given the size of the engine, there is no room for weapons bays.

Therefore, munitions would have to be carried externally, destroying the stealth signature.

The UAV could be used for high altitude ISR.

6,920 posted on 10/05/2024 7:27:28 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 6918 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 6,881-6,9006,901-6,9206,921-6,940 ... 8,101-8,108 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson