Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 5,821-5,8405,841-5,8605,861-5,880 ... 21,001-21,005 next last
To: JonPreston

Stalingrad, Berlin, Selydove??? Jonnyboy, is it true you have self deported to Mother Russia? If so, congrats. Sorry to say I wasn’t able to help you pack. May you find the golden squat toilet of your dreams there.


5,841 posted on 08/28/2024 6:04:43 PM PDT by lodi90
[ Post Reply | Private Reply | To 5836 | View Replies]

To: lodi90

5,842 posted on 08/28/2024 6:21:34 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 5841 | View Replies]

To: PIF; lodi90
Kursk Failed


5,843 posted on 08/29/2024 2:22:52 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 5834 | View Replies]

Russian Offensive Campaign Assessment, August 28, 2024

Multiple reports from Western media indicate that the US government is prohibiting the United Kingdom (UK) from allowing Ukraine to use Storm Shadow missiles to strike military targets in Russia. The Financial Times (FT) reported on August 27 that a source familiar with the matter stated that Ukraine's use of British and French Storm Shadows may require access to American intelligence, surveillance, and reconnaissance in areas where Russian forces are jamming the GPS signals that the missiles use for targeting.[1] FT reported that “well-placed” sources stated that the UK government sent a request to both the US and France earlier in summer 2024 to grant Ukraine permission to use Western-provided weapons to strike military targets in Russia, and French President Emmanuel Macron stated in May 2024 that Ukraine should be allowed to strike military sites in Russia from which Russian forces attack Ukraine. The Telegraph reported on August 27 that the UK government supports Ukraine's ability to strike military targets in Russia with Storm Shadow missiles but that the missiles also use unspecified, classified American systems, whose use requires US permission.[2] The Telegraph stated in a since-deleted section of its original web article that the UK has not formally asked the US to allow Ukraine to use Storm Shadows to strike military targets within Russia, and that a White House source stated that the US is concerned about how the use of the missiles — even without US approval — could escalate the situation and draw the US into the war in Ukraine. The Telegraph reported that British Prime Minister Keir Starmer is taking a “consultative approach” to negotiations with the US and does not want to spark a disagreement over the issue. A source in the UK government reportedly stated that Russia is aware that Ukraine is asking for permission to strike military targets in Russia, so Russia has moved its “most critical assets” out of range of long-range missile systems. ISW continues to assess that although Russian forces have moved aircraft out of range of Western-provided Storm Shadow and ATACMS missiles, a significant number of Russian military objects remain within striking distance of Western weapons, restrictions on which are allowing Russian forces to leverage sanctuary space in deep rear areas within Russia to support military operations against Ukraine.[3]

Kremlin Spokesperson Dmitry Peskov denied reports on August 28 that Russian conscripts are fighting in Kursk Oblast and called such reports a “distortion of reality,” despite a plethora of evidence, including Russian evidence and admissions, to the contrary.[11] Chechen Republic Head Ramzan Kadyrov, Chechen Akhmat Spetsnaz Commander Apty Alaudinov, and other Russian sources have notably acknowledged that Russian conscripts are fighting in Kursk Oblast.[12] Russian opposition outlet Horizontal 7x7 reported on August 28 that Kremlin-controlled social media site VKontakte (VK) removed a local Ivanovo Oblast news outlet's post claiming that the Russian military is sending Airborne Forces (VDV) conscripts to Kursk oblast.[13] Horizontal 7x7 noted that the Ivanovo Oblast Human Rights Ombudsman previously stated that a conscript from Ivanovo Oblast returned to Russia during a prisoner-of-war exchange.[14] Russian opposition outlet Mobilization News reported that the Russian military plans to deploy Russian conscripts from the 290th Missile Regiment (7th Missile Corps, 27th Missile Army, Strategic Missile Forces) and 2187th VDV Regiment (98th VDV Brigade) to Kursk Oblast.[15]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-august-28-2024

5,844 posted on 08/29/2024 2:59:39 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 5803 | View Replies]

To: PIF

Re Peskov

Russian blogger:
https://freerepublic.com/focus/bloggers/4219673/posts?page=5834#5834


5,845 posted on 08/29/2024 3:01:56 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 5844 | View Replies]

No milk fuel today

Russian blogger

The army is already complaining about the fuel shortage. So far anonymously and very carefully.

Against the backdrop of the Ukrainian Armed Forces’ strikes on Russian oil depots, alarm bells are coming from the army. Some servicemen claim that their units have been restricted in fuel consumption. Including in the SVO zone, where our guys carry out combat missions. Off the record, familiar officers hint that the problem, for example, in Crimea, the DPR and the Zaporozhye region, arose after a series of strikes on oil depots in the Rostov region.

“We understand that there may be temporary restrictions. And in general, it is clear that you can always cut back. The car won't make it to the liquor store one more time - no big deal,” a familiar officer who serves in Dzhankoy answered bravely.

Our interlocutor from Melitopol noted that there are no strict limits yet, but conversations are already underway. “We are working with the personnel. We are talking about the fact that there may be a shortage of fuel. We are making additional reserves. All adults should understand. Of course, there are some “unique individuals” to whom “the state owes everything”. But this is war, you need to understand,” the channel's source said.

https://t.me/kremlin_secrets/4581

5,846 posted on 08/29/2024 3:06:21 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 5845 | View Replies]

Russian blogger

Have you noticed that after the Kursk breakthrough of the Ukrainian Armed Forces there were no purges in the Ministry of Defense?

An interesting situation - Andrei Belousov, after joining the Ministry of Defense, started serious personnel purges there. Naturally, with the help of the FSB. The generals who remained on board had to either show their loyalty, or at least not interfere with serious reforms.

It is impossible to say much about Belousov’s reforms yet. And it is problematic to do this in the conditions of war, but the detentions of generals have stopped. Now the army must master the offensive in Donbass, as well as get its bearings and finally fight back in the Kursk region. There is a consensus on the last point that this will not happen in the coming weeks, since the scale of the problems is enormous.

At the same time, no one has been held accountable even for the Kursk failure of the Russian Armed Forces. I would like to believe that for now. But judge for yourself - the Ukrainian Armed Forces invaded the territory of the Kursk region and captured more than 1000 square kilometers of our land. Conscripts were killed, hundreds of soldiers were captured. Who will answer? And there is no one to answer... And this is strange.

Perhaps Andrei Removich should sort out the situation?

https://t.me/kremlin_secrets/4582

5,847 posted on 08/29/2024 3:08:49 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 5846 | View Replies]

To: gleeaikin

they could have spent some more time and money in those states, which could have changed the final EC vote.


Wrong. The Dem poll workers in key precincts would have just run more boxes of ballots through the counting machines more times. That’s how WI counted their winning 20K votes in Dane and Milwaukee counties where 110-120% of registered voters cast ballots.

This will be part of how the Dems cheat in Nov. Already stories are appearing that poll worker positions are going mostly and overwhelmingly to Democrats.


5,848 posted on 08/29/2024 3:09:27 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 5840 | View Replies]

To: gleeaikin
“SVR General”

The Russian leadership, or rather the so-called “politburo 2.0” is seriously alarmed by the information about the “movement” that some former Wagner PMC fighters have joined. For several days now, reports from representatives of the leadership of the security bloc have been saying that in different regions of Russia, former Wagner PMC fighters “are receiving signals” with hints “to be ready for any events in September.” The signals are allegedly being sent by people who were close to Yevgeny Prigozhin.

It is believed that at least 50 people have been notified. Most of these people have already been visited by Russian “law enforcement officers” with inspections and searches, and they have all been talked to about the need to strictly comply with the law, and all contacts, or attempts at contact, with former colleagues from the Wagner PMC should be immediately reported to the curator. Despite the quick response of Russian security forces, there is an assumption that less than 50% of contacts have been identified, and, in connection with this, there is an order to strengthen control over all former Wagner members throughout the country. Under special control are former commanders and fighters who came under the control of the Ministry of Defense and the Russian Guard. Some former Wagner PMC fighters, with whom an interview was conducted, admitted that they consider Yevgeny Prigozhin alive and believe that the signal could have been received at his location.
https://t.me/generalsvr/2641

5,849 posted on 08/29/2024 3:13:15 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 5847 | View Replies]

To: BeauBo

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view. ]

The complete transcript.

[ New Ukrainian Missile-Drones with Cluster Munitions Annihilate Russian Airbases
Reporting from Ukraine ]


Today [ Aug 29 ], there are a lot of updates from the Kursk direction.

Here, in a bold and strategic maneuver, Ukrainian forces have successfully encircled several key settlements, effectively isolating substantial Russian troop formations and setting the stage for intense clashes.

As the encirclement tightens, the trapped Russian forces face the prospect of imminent Ukrainian offensives, some of which have already resulted in devastating losses for the Russians.

Recently, Ukrainian Commander-in-Chief Oleksandr Syrsky revealed a map during a televised session of the Ukrainian Congress of Local and Regional Authorities, showcasing the current front line in Kursk Oblast. Notably, Syrsky’s map substantiated earlier speculations, highlighting several “cauldrons” where Russian troops are effectively surrounded and cut off from their supply lines.

One of the most notorious “cauldrons” has formed north of Sudzha, near Malaya Loknya, marking a significant tactical victory for Ukrainian forces. In the early stages of the Kursk incursion, Ukrainian sabotage and reconnaissance units executed a deep penetration into Russian-held territory, advancing over 15 kilometers north of Malaya Loknya along the road to Lgov.

This swift and decisive maneuver was crucial in encircling the Russian forces. The unexpected speed and depth of the Ukrainian advance caught the Russian troops off guard, leading to the entrapment of a substantial number of Russian units in Malaya Loknya at the very outset of the offensive, paving the way for their prolonged isolation.

Ukrainian sabotage and reconnaissance groups effectively employed ambush tactics along key routes, preventing Russian forces from regrouping or escaping the area. These strategic actions were crucial in maintaining the isolation of the encircled Russian units, cutting off any potential reinforcements or escape routes.

As a result of this sustained isolation, most of the trapped Russian forces were either annihilated in combat or forced to surrender. However, unlike other encircled Russian troops, those in Malaya Loknya have managed to hold out much longer.

Their prolonged resistance can be attributed to their use of the former women’s penal colony as a fortified stronghold. The prison complex’s robust infrastructure has provided significant defensive advantages, enabling these forces to resist far longer than others in similar situations.

Recent reconnaissance data confirms that Ukrainian forces have successfully secured critical terrain features and transportation routes in all directions surrounding Malaya Loknya. This thorough control of the flanks has established a multi-layered defense system, effectively stifling any potential Russian breakout attempts.

Recently published geolocated images reveal intense Ukrainian assaults on the surrounded Russian forces in the area. The images capture the prison pavilions in the background while a German-made BMP “Marder” infantry fighting vehicle from the 95th Air Assault Brigade unleashes a powerful attack on two auxiliary buildings adjacent to the prison fences.

The Marder’s 20mm autocannon obliterates these structures, reducing them to ashes. Another video, also filmed near the prison, shows Marder vehicles utterly destroying several nearby buildings, further tightening the noose around the beleaguered Russian troops.

However, this was only the beginning. Ukrainian forces are now establishing a second, potentially even more devastating, cauldron just 12 kilometers east of the first one. Russian military analysts report that Ukrainian troops are encircling Russian forces in Martynovka.

A glance at the topographic map reveals Martynovka’s strategic significance: situated just 5 kilometers northwest of Sudzha on elevated ground, it sits at the foot of the R200 highway - a crucial artery for troop movements and logistical supplies.

Securing the front line beyond Martynovka is a critical priority. If this position were to fall into Russian hands, the defense of Sudzha would be severely compromised. Martynovka’s elevated location, proximity to Sudzha, and access to a key logistical supply route, make it a strategic linchpin that could greatly enhance Russian control over the area.

Ukrainian forces have advanced to encircle Martinova from the north, pushing toward Pushkarnoe, while another offensive is advancing from the south originating from Russkaya Konopel’ka,now fully under Ukrainian control.

This maneuver poses a significant threat to the Russian troops who are at risk of being trapped in the cauldron, without the possibility of escape As a result elements of the Russian 810th Naval Infantry Brigade have been caught in a pocket within the Martynovka.

A significant incident widely reported by Russian forces involved images of a soldier from the Russian 11th Airborne Brigade allegedly leading conscripts out of the Martynovka pocket.

The footage shows the veteran paratrooper recording himself as he guides a single file line of conscripts out of the encirclement. This event underscores that even 3 weeks into the Kursk incursion, Russian forces have resorted to deploying conscripted soldiers in some of the most critical and intense areas of the conflict.

Professional units are being concerned served, typically deployed only in desperate situations where poorly trained conscripts are unable to offer effective resistance.

Overall, the formation and maintenance of the Malaya Loknya and Martynovka cauldrons highlight the strategic and tactical proficiency of Ukrainian forces in this offensive. These operations demonstrate their capability to execute deep penetration maneuvers, effectively isolate enemy units and consolidate territorial gains, despite counterattacks.

Additionally, the ongoing deployment of Russian conscripts, even at critical points near Sudzha, suggests that Russian commanders are still grappling with the challenge of minimizing troop and reserve redeployment from other front lines, particularly in Southern and Eastern Ukraine.

The situation, presents favorable prospects for the further expansion and consolidation of Ukrainian controlled territory in the Kursk region.


5,850 posted on 08/29/2024 3:47:06 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 5833 | View Replies]

To: PIF

Correct tile:

Ukrainian Forces Encircle and Destroy Russian Troops in Kursk Offensive


5,851 posted on 08/29/2024 3:49:45 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 5850 | View Replies]

To: PIF

Correct tile:

Correct Title:

[ I seem to be having one of Those mornings. ]


5,852 posted on 08/29/2024 3:51:19 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 5851 | View Replies]

Stelmakhivka And Synkivka Have Fallen⚔️ Russians Are Storming Selydove💥 Military Summary 2024.08.29

Onward

5,853 posted on 08/29/2024 3:53:03 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 5851 | View Replies]

To: gleeaikin

Perhaps I wasn’t clear, yes she lost because of the EC, until they can change that to popular vote, that is the only way to determine win or lose.

My point is not about votes earned, but about votes created. To be clear fraud.

Hitlary , my opinion, didn’t recognize the level of legal vote support for Trump and misjudged the votes they needed to create esp in swing states t needed to pull a win
With xiden they over compensated creating a 10 million(if I remember correctly) popular vote win, but still they had issues. Post election night showed that.

Hell I even found a box of filled out ballots in my trunk all for xiden/s

To directly answer your point hitlary didn’t lose because she didn’t campaign effectively and efficiently though things like “basket of deplorables “ didn’t help, she lost because the fraud machine wasn’t perfected and they were arrogant

The chaos that happened days, weeks, and months after xiden’s win shows that even his “ We have put together I think the most extensive and inclusive voter fraud organization in the history of American politics”( some say taken out of context I say Freudian slip) was not perfect and they had to go into overdrive, optics and the law be damned, to get him across the finish line “first”


5,854 posted on 08/29/2024 4:20:18 AM PDT by blitz128
[ Post Reply | Private Reply | To 5840 | View Replies]

To: AdmSmith

Saw a complaint from a civilian airline pilot that they are being required to fly with minimum fuel which leaves no extra for weather deviations, fly around ss, or deviations to alt airfields


5,855 posted on 08/29/2024 4:37:39 AM PDT by blitz128
[ Post Reply | Private Reply | To 5846 | View Replies]

To: PIF
Footage of the Russian T-90M "Proryv" (Breakthrough) tank near Maryinka in Donetsk region.

An $500 drone burns through the "best tank in the world" (according to Russian propaganda), worth about $4 million, burns through its defense and causes the ammunition to detonate.

Amazing work of the pilots from the 46th separate airmobile brigade. Glory!

https://x.com/Gerashchenko_en/status/1829115263985299809


5,856 posted on 08/29/2024 5:41:53 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 5852 | View Replies]

To: PIF
According to Russian sources, Tetkino is cut off. All bridges over the Seym River are taken out.

"Tetkino is cut off, there are no crossings or bridges."

They add that "the enemy tries to develop success in the direction of Zhuravli-Kremyanoe and then intends to go to Korenevo."

https://x.com/NOELreports/status/1829134331924639787

There are various numbers circulating about the remaining contingent of Russian forces. Estimates go between 1000 and 3000 Russian forces that are now blocked south of the Seym River.

https://x.com/NOELreports/status/1829134820703678780


5,857 posted on 08/29/2024 5:47:51 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 5856 | View Replies]

To: PIF
The Ukrainian Air Force reports on a combined missile and drone attack overnight.

Shot down:
2/3 Kh-59/69 cruise missiles
60/74 Shahed drones

Another 14 drones were lost and fell somewhere in Ukrainian territory, possibly due to electronic warfare measures.

In addition Russia attacked with two cruise missiles of an unknown type of which information is now being clarified.

https://x.com/NOELreports/status/1829059134957789600


5,858 posted on 08/29/2024 5:59:51 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 5857 | View Replies]

Commander of the Armed Forces stated that Ukraine may deploy Dutch F-16s in Russia.

https://x.com/wartranslated/status/1829109310099452018

F-16s can employ SDBs or JDAM-ER on Kursk targets without entering ruzzian airspace.

5,859 posted on 08/29/2024 6:05:19 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 5858 | View Replies]

To: BeauBo
I believe the previous fire is out...11 days.

How many days will this depot burn?

🔥❗️High alert mode introduced in Kamensky district of Rostov region due to burning oil depot.

It is not yet possible to bring the flames under control.

https://x.com/Maks_NAFO_FELLA/status/1829135378999042497

Kamensky district of Rostov region on Google Maps


5,860 posted on 08/29/2024 6:11:29 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 5859 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 5,821-5,8405,841-5,8605,861-5,880 ... 21,001-21,005 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson