Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

click here to read article


Navigation: use the links below to view more comments.
first previous 1-20 ... 3,701-3,7203,721-3,7403,741-3,760 ... 6,241-6,250 next last
To: SpeedyInTexas

“The U.S. and Germany announced episodic deployments of longer-range American missiles in Germany starting in 2026.”

Unstated, was whether or not they were nuclear.

Perhaps Finland would like some too. They have long chafed under the gun of Russian nuclear threats. They have built enough nuclear shelters to house their whole population


3,721 posted on 07/11/2024 8:38:12 AM PDT by BeauBo
[ Post Reply | Private Reply | To 3718 | View Replies]

To: BeauBo; All

More Winning.

“European Nations Plan New Long-Range Missiles to Ease US Burden”

“France, Germany, Italy and Poland announce development plan”

“European NATO members seek to demonstrate defense commitments”

“France, Germany, Italy and Poland plan to design and build long-range missiles as Europe steps up efforts to strengthen its military capabilities.

“This is clearly a segment we don’t have,” French Defense Minister Sebastien Lecornu told reporters Thursday on the sidelines of a NATO summit in Washington. The initiative will allow for “long-range and deep-fire capacity,” he said.”

https://archive.ph/3M8TZ


3,722 posted on 07/11/2024 8:42:12 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 3721 | View Replies]

To: SpeedyInTexas

Precision Strike Missile (PrSM) 310 mile range


3,723 posted on 07/11/2024 9:01:00 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 3718 | View Replies]

To: PIF

Increment One Precision Strike Missile (PrSM):
310 mile range

Increment Two (2028)
expected 1,000 km range

Increment Three
anti-fortification weapon

Increment Four
1000+km range


3,724 posted on 07/11/2024 9:06:25 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 3723 | View Replies]

To: BeauBo
Unstated, was whether or not they were nuclear.

The announcement said SM-6 and Tomahawk. This the US Army's new Long Range Fires program. While most people know plenty about the newest versions of the Tomahawk, few know much about the shore based version of the US Navy's premier SM-6 Surface to Air Missile being configured as a long range strike weapon.

3,725 posted on 07/11/2024 10:10:31 AM PDT by ETCM (“There is no security, no safety, in the appeasement of evil.” — Ronald Reagan)
[ Post Reply | Private Reply | To 3721 | View Replies]

To: PIF; All

From report 2 years ago, UN now expects China’s population to decline by an additional 130 million (766 million to 639 million). From 1.4 billion to 639 million by 2100. Just Stunning.

We have truly seen Peak China. I believe that completely.

RuZZia is a declining power. The Ukraine War has cemented RuZZia’s future. The West needs to manage that decline.

I expect China’s relative power to stabilize over the next couple of decades before a serious economic / national decline. When you lose 800 MILLION people, you’ve lost your future power.

This century will be Another American Century.

The history books have my permission to use that slogan.

////

“The One-Child Policy Supercharged China’s Economic Miracle. Now It’s Paying the Price.”

“Revised U.N. data shows the speed of China’s aging after it accelerated its ‘demographic dividend’”

“When China launched its one-child policy more than four decades ago, it sped up an evolution toward smaller family sizes that would have happened more gradually.

The policy supercharged the country’s workforce: By caring for fewer children, young people could be more productive and put aside more money. For years, just as China was opening its economy, the share of working-age Chinese grew faster than the parts of the population that didn’t work. That was a big factor in China’s economic miracle.

There was a price and China is now paying it. Limiting births then means fewer workers now, and fewer women to give birth. A United Nations forecast published Thursday shows how quickly China is aging, a demographic crunch that the U.N. predicts will cut China’s population by more than half by the end of the century.

In the late 1970s, China’s leaders feared a population explosion that would drain the country’s resources. When Deng Xiaoping rolled out the one-child policy nationwide in 1980, he said, “We must do this. Otherwise, our economy cannot be developed well.”

A young population has helped drive economic growth in developing countries across the world, including in China’s neighbor Japan starting in the 1950s. Economists call it a demographic dividend—the window, generally of a few decades, when a country has far more working-age people than young and elderly dependents. As such countries grow wealthier, people naturally choose to have fewer children and the population starts to age.

That was also the trajectory in China—just faster.

Knowingly or not, China essentially borrowed from its own future by accelerating its so-called demographic window. How the effects of the policy have sped up China’s demographic bind is scrambling the long-term models demographers usually work with.

“The challenge with China is that from one year to another the situation can change quite fast,” said Patrick Gerland, head of the U.N.’s population estimates and projection section. “Within the last decade, the changes have been very big, both in policy and in the numbers.”

For example, in its just-published global estimates, the U.N. expects China’s population to drop from 1.4 billion today to 639 million by 2100, a much steeper drop than the 766.7 million it predicted just two years ago.”

https://www.wsj.com/world/china/china-population-slowing-economy-7ff938e5?mod=hp_lead_pos7


3,726 posted on 07/11/2024 10:42:04 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 3724 | View Replies]

To: PIF; All

Another estimate is for ANOTHER 100 MILLION fewer people.

“Even so, the U.N.’s prediction looks optimistic compared with other estimates. Researchers from Victoria University in Australia and the Shanghai Academy of Social Sciences have predicted that China will have just 525 million people by the end of the century. “

That would be a loss of 900 MILLION people.


3,727 posted on 07/11/2024 10:49:16 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 3726 | View Replies]

To: PIF; All

“Now, slowing economic growth and demographic changes feed off each other for a gloomy outlook.

“People always count on the [Chinese] government to do more to prop up the economy but the reality is that there’s not a lot the government can do,” Wang said.”


3,728 posted on 07/11/2024 10:51:38 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 3727 | View Replies]

To: SpeedyInTexas
Russian plot to kill European weapons chief foiled by US and Germany
Rheinmetall is Germany's largest manufacturer of 155mm artillery shells, a crucial resource for Ukrainians defending themselves against Russia's war.

“In view of the latest reports on Rheinmetall, this is what we have actually been communicating more and more clearly in recent months. Russia is waging a hybrid war of aggression,” Annalena Baerbock, Germany's foreign minister, said Thursday evening on the sidelines of the NATO summit in Washington.

“We have seen that there have been attacks on people on European territory. We have seen that there have been attacks on factories. And this underlines once again that we as Europeans must protect ourselves as best we can and not be naive,” she continued.

U.S. intelligence services discovered the plot to kill Papperger earlier this year, subsequently informing Germany, whose security services were then able to foil the plot, a senior German government official told CNN.

It would not be the first time Russia has been accused of plotting an assassination to potentially take place on German soil.

In 2021, Vadim N. Krasikov, whom German authorities identified as an employee of the F.S.B., Russia's domestic spy service, was convicted of murdering a Chechen former separatist in broad daylight in a Berlin park two years earlier. After the conviction, Germany expelled two Russian diplomats, and tensions between the countries escalated markedly.

In June, Western security officials blamed Russia for a fire at a metal factory belonging to defense manufacturer Diehl in Berlin.

Sara Nanni, a German Greens MP and member of the defense committee, said in a post on X that “this is all part of Russia's war against Ukraine.”

“But we must be clear: we are also being targeted. The point of such actions is to deter the industry from actively participating in the defense — of Ukraine and ours,” Nanni said.

https://www.politico.eu/article/russia-plot-kill-arms-manufacturer-rheinmetall-ceo-armin-papperger-foiled-us-germany-cnn/

3,729 posted on 07/11/2024 10:59:29 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 3728 | View Replies]

To: ETCM; PIF; SpeedyInTexas

“This is the US Army’s new Long Range Fires program.” (which is preparing rotating deployments to Germany in 2026)

It is going to present problems for Russia, as well as China.

Of note, the other Services also have programs to address the Intermediate Range (500 to 5,500 kilometers). Those are going to start showing up too, on their own timelines. I believe that the intent is to share Ballistic and Cruise Missiles with such ranges among the Services, as well as boost-glide hypersonics, adapting them to launch from land, sea or air.

Congressional Research Service described the US Army’s Long Range Fires program (in 2021):

“Both the 2018 National Defense Strategy and the Army’s Multi-Domain Operations operational concept call for improved
Army LRPF capability to counter what has been described as Russian and Chinese anti-access, area denial (A2/AD)
strategies designed to limit the freedom of movement and action of U.S. forces in both Europe and the Pacific region.

The Army has five major programs or efforts underway or under consideration to improve long-range precision fires
capabilities:

- The Extended Range Cannon Artillery (ERCA) program plans to develop a system capable of accurately firing at targets more than 70 kilometers away, an improvement over the 30-kilometer target distance of current systems.

- The Precision Strike Missile (PrSM)is a surface-to-surface, all weather, precision-strike guided missile fired from the M270A1 Multiple Launch Rocket System (MLRS) and the M142 High Mobility Artillery Rocket System (HIMARS). PrSM is intended to replace current MLRS and HIMARS missiles and doubles
the current rate-of-fire, with two missiles per launch pod.

- The Army is examining the feasibility of developing a Strategic Long-Range Cannon (SLRC)that can fire a projectile at hypersonic speeds up to 1,000 miles to engage air defense, artillery, and missile systems and command and control targets.

- The Army, Navy, Air Force, and Missile Defense Agency (MDA) are developing a Common-Hypersonic Glide Body (C-HGB), which the Army plans to use as part of its Long-Range Hypersonic Weapon (LRHW) program, enabling the C-HGB to be launched from mobile Army ground missile launchers.

- Finally, the Army is attempting to modify existing Navy SM-6 and UGM-109 Land Attack Missiles for ground launch to provide the Army with a mid-range missile capability.”


3,730 posted on 07/11/2024 11:03:41 AM PDT by BeauBo
[ Post Reply | Private Reply | To 3725 | View Replies]

To: PIF; All

Its actually even worse.

Of the 525-639 million population in 2100, almost half will be over 65! Just Stunning.

“By 2050, the U.N. now projects 31% of Chinese will be 65 or older. By 2100, the share will be 46%, approaching half of the population. In the U.S., the share is expected to be 23% and 28%, respectively. “


3,731 posted on 07/11/2024 11:35:48 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 3730 | View Replies]

To: PIF; All

Looks inevitable now.

“Some Biden Advisers Are Discussing How to Convince Him to Step Aside”

“Some longtime aides and advisers to President Biden have become increasingly convinced that he will have to step aside from the campaign, and in recent days they have been trying to come up with ways to persuade him that he should, according to three people briefed on the matter.

A small group of Mr. Biden’s advisers in the administration and the campaign — at least two of whom have told allies that they do not believe he should keep trying to run for a second term — have said they would have to convince the president of several things.

They said they have to make the case to the president, who remains convinced of the strength of his campaign, that he cannot win against former President Donald J. Trump. They have to persuade him to believe that another candidate, like Vice President Kamala Harris, could beat Mr. Trump. And they have to assure Mr. Biden that, should he step aside, the process to choose another candidate would be orderly and not devolve into chaos in the Democratic Party.”

https://archive.ph/WFtVo


3,732 posted on 07/11/2024 11:47:50 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 3731 | View Replies]

To: PIF; All

Kamala, Willie Brown’s mistress, vs Trump???

“Biden Campaign Quietly Tests Kamala Harris vs. Trump”

“As President Biden faces growing calls from nervous Democrats to end his re-election bid, his campaign is said to have surveyed voters to assess the vice president’s strength against former President Donald J. Trump.”

https://archive.ph/89EAC


3,733 posted on 07/11/2024 11:50:41 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 3732 | View Replies]

To: PIF; All

“Ukraine Says It Seized Vessel That Had Ferried ‘Looted’ Grain”

“Ukraine has seized a cargo vessel that it claims has ferried “looted agricultural products” procured from its Russian-occupied territories, the first such action since Moscow’s invasion in 2022.

The vessel, USKO MFU, sailing under a Cameroon flag, had entered and left Sevastopol port to collect agricultural goods, according to a statement on the website of Ukraine’s General Prosecutor. The nation officially stopped using that port after Russia occupied the peninsula in 2014 and it is sanctioned by the European Union and US. The ship’s captain has also been detained.

“The ship repeatedly docked at the seaport of Sevastopol to pick up looted agricultural products” in 2023 and 2024, Ukraine’s Security Services said in a statement on Thursday. The vessel was the first to be seized “since the beginning of Russia’s full-scale aggression,” the country’s top government prosecutor Andriy Kostin said in a statement on social media platform X. “Previously, such arrests were made only in absentia.””

https://archive.ph/zV0Nl


3,734 posted on 07/11/2024 12:00:24 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 3733 | View Replies]

To: SpeedyInTexas

Another factor, despite official statistics to the contrary, 80% of China’s population lives in poverty.


3,735 posted on 07/11/2024 12:11:32 PM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 3726 | View Replies]

To: SpeedyInTexas

The NFP coalition was formed with no regard for a common platform, and now they are struggling to agree on a Prime Minister.

https://www.lemonde.fr/en/politics/article/2024/07/11/french-elections-the-left-is-under-pressure-to-agree-on-a-prime-minister-candidate_6681332_5.html


3,736 posted on 07/11/2024 2:59:03 PM PDT by ETCM (“There is no security, no safety, in the appeasement of evil.” — Ronald Reagan)
[ Post Reply | Private Reply | To 3594 | View Replies]

Today’s $250M aid package. Interesting valuation, as a Patriot battery alone is 4X that price...

The capabilities in this announcement include:

• One Patriot battery;
• Munitions for National Advanced Surface-to-Air Missile Systems (NASAMS);
• Stinger anti-aircraft missiles;
• Ammunition for High Mobility Artillery Rocket Systems (HIMARS);
• 155mm and 105mm artillery rounds;
• Tube-Launched, Optically-Tracked, Wire-Guided (TOW) equipment and missiles;
• Javelin and AT-4 anti-armor systems;
• Small arms ammunition;
• Demolitions munitions; and
• Spare parts, maintenance, and other ancillary equipment.

https://www.defense.gov/News/Releases/Release/Article/3835746/biden-administration-announces-additional-security-assistance-for-ukraine/


3,737 posted on 07/11/2024 3:33:09 PM PDT by ETCM (“There is no security, no safety, in the appeasement of evil.” — Ronald Reagan)
[ Post Reply | Private Reply | To 3736 | View Replies]

To: ETCM

NFP could break up and some of them support a Macron led government.


3,738 posted on 07/11/2024 3:40:10 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 3736 | View Replies]

To: BeauBo
a ground-launched version of an air-to-ground weapon had become vulnerable to Russian electronic warfare. The publication said he was likely referring to the GLSDB...

Interesting that the SDB seems more jam resistant when air launched. I'm guessing the IMU is confused by the launch ground launch sequence, and with jamming can't get reliable position updates to recover. Either a new M-code GPS receiver or some other update to the system might be able to increase jamming resistance. Or use Home on GPS Jam seeker (HOG-J) for the first salvo.

3,739 posted on 07/11/2024 3:46:04 PM PDT by ETCM (“There is no security, no safety, in the appeasement of evil.” — Ronald Reagan)
[ Post Reply | Private Reply | To 3705 | View Replies]

To: SpeedyInTexas

“Some longtime aides and advisers to President Biden have become increasingly convinced that he will have to step aside from the campaign, and in recent days they have been trying to come up with ways to persuade him that he should”

Babylon Bee had a story about Nancy Pelosi trying to convince old Joe that he stepped down yesterday.


3,740 posted on 07/11/2024 7:54:43 PM PDT by BeauBo
[ Post Reply | Private Reply | To 3732 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 3,701-3,7203,721-3,7403,741-3,760 ... 6,241-6,250 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson