Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 0putinsfolly; 0putinswar; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynow; anydaynowputinwins; anydaynowrussiawins; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; jonputinbot; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 3,641-3,6603,661-3,6803,681-3,700 ... 22,001-22,013 next last
To: SpeedyInTexas

“United States, Germany & Romania. The Netherlands & others are donating Patriot parts to enable another battery while Italy is giving them a SAMP-T.”

Where is France in that list?

Of the major economies in Europe, France seems to proportionally contribute the least, even without Le Pen.


3,661 posted on 07/09/2024 7:01:22 PM PDT by BeauBo
[ Post Reply | Private Reply | To 3659 | View Replies]

To: FtrPilot

“If NATO countries stand tall and continue to meet their commitments then I believe Chuck is correct.”

He also had a very similar caveat, with his statements.


3,662 posted on 07/09/2024 7:10:02 PM PDT by BeauBo
[ Post Reply | Private Reply | To 3646 | View Replies]

To: BeauBo

“France seems to proportionally contribute the least”

I agree with you.

Macron hasn’t walked the talk.


3,663 posted on 07/09/2024 7:20:17 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 3661 | View Replies]

To: FtrPilot
The Express (UK) reports:

"Ukraine launched devastating drone attacks throughout Russia in the early hours of Tuesday, hours after Russian missiles struck a children's hospital in Kyiv.

Five drones struck oil facilities in Kalach-on-Don in the Volgograd region, causing a massive blaze.

Video images of the fire show huge balls of flames pouring from the facility and a column of thick black smoke rising into the sky.

The region's governor Andrei Bocharov claimed the fires were caused by falling debris from drones shot down by Russian air defence systems."


3,664 posted on 07/09/2024 7:21:57 PM PDT by BeauBo
[ Post Reply | Private Reply | To 3646 | View Replies]

To: AdmSmith; Chad C. Mulligan; PIF; Monterrosa-24

What, we don’t have enough nitrocellulose? Aren’t we still a big cotton producing country? If we can rebuild our chip industry with Taiwanese help, surely we should be able to improve nitro production. I understand that in the US this is an issue for people who like to load their own bullets or something. Surely the NRA could lean on some Congresscritters to get nitro produced in the US. We certainly must need it to rebuild our missile supplies.


3,665 posted on 07/09/2024 7:55:21 PM PDT by gleeaikin ( Question authorityan you provide links)
[ Post Reply | Private Reply | To 3650 | View Replies]

To: blitz128; SpeedyInTexas; PIF; BeauBo

“IMO they want Trump less, what they want is to SOW DIVISION and CONFLICT in US.”

Exactly!. A man named Alexandr Dugin in 1997 wrote a book, Foundations of Geopolitics, link below, and he is now called Putin’s Brain. Putin requires it to be taught in Russian military colleges, and wants it taught in high schools.

https://en.wikipedia.org/wiki/Foundations_of_Geopolitics#Policy_usage

There are over 20 bullet points which outline his plan for conquering Western Europe, and controlling the rest of the world. See the paragraph on plans for division and conflict in North America and the US.

“* Russia should use its SPECIAL SERVICES within the borders of the United States and Canada to fuel instability and separatism against neoliberal globalist Western hegemony, such as, for instance, provoke Afro-American racists to create severe backlash against the rotten political state of affairs in the current present-day system of the United States and Canada. Russia should introduce geopolitical disorder into internal American activity, encouraging all kinds of separatism and ethnic, social, and racial conflicts, actively supporting all dissident movements— extremist, racist, and sectarian groups, thus destabilizing internal political processes in the U.S. It would also make sense simultaneously to support isolationist tendencies in American politics.
* The Eurasian Project could be expanded to Central and South America.[9]”

Believe what you just read above, the Russian Special Services are hard at work disrupting our elections, and no doubt are the reason for some of the more nasty conflict occurring right here on Free Republic. All this fuss about using 5% of our military budget to help Ukraine kick Russia out of their own country has got to be Russian propaganda, and makes sense given that Russia is having to spend at least 7% of their entire national budget specifically on this war. PLEASE pass this link on to your friends. This book is as important as Hitler’s Mein Kampf was in the 1930s. If only enough people had read and believed him, we might have stopped WW2. Don’t let it happen to us again.


3,666 posted on 07/09/2024 8:41:54 PM PDT by gleeaikin ( Question authority an you provide links)
[ Post Reply | Private Reply | To 3656 | View Replies]

To: gleeaikin
What, we don’t have enough nitrocellulose?

This bothers me, too. Making nitrocellulose is a low tech process, easy to scale up. Used to use cotton linters, but now I'm reading that they start with wood. An aspect of the powder famine for us reloaders is that so much of what we buy is actually made as far away as Australia. And we are just a small fraction of the overall demand, so we get cut off first. In WW2 the civilian market went dry for five years. I'm sure the hoplophobes on the Left are ecstatic hearing that.

3,667 posted on 07/09/2024 8:46:24 PM PDT by Chad C. Mulligan
[ Post Reply | Private Reply | To 3665 | View Replies]

To: gleeaikin

For a while I thought there were only a few paid Russian trolls (true Russian nationals) infecting FR. I was naive. Russia spends the big bucks on propaganda and controls their own social media and attempts to control Ukraine’s, America’s, and western Europe’s.

I remember back in the 1980s being frustrated with the depiction of El Salvador in American media. At that time the communist FMLN front groups had information offices in many large cities and universities around the world … more than the government of El Salvador had embassies and consulates. Front groups like CISPES (Committee in Solidarity with the People of El Salvador) and Christian Education Seminars were well funded while anti-communist writers in El Salvador like Mario Rosenthal operated on shoe string budgets. Now it is the same as the extreme Left outspends us again.


3,668 posted on 07/09/2024 10:16:45 PM PDT by Monterrosa-24 (Saludemos la patria orgullosos)
[ Post Reply | Private Reply | To 3666 | View Replies]

To: gleeaikin; BeauBo; SpeedyInTexas; PIF; blitz128; Chad C. Mulligan; MeganC
I have little doubt that Russian inflation is well above the 8% figure

Yes, it is much higher, one indication is:

The average mortgage interest rate in large banks has approached 20%, according to Dom.RF. A loan for the purchase of housing in a new building can be obtained at an average of 19.46%, for secondary housing - 19.69%. At the same time, rates continue to rise: this week, Alfa-Bank, Crimean RNKB, MTS-Bank and Bank Saint Petersburg decided to increase further.

https://t.me/bankrollo/29125

Probably > 15 %

3,669 posted on 07/10/2024 12:56:22 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 3640 | View Replies]

To: Monterrosa-24
Russia spends the big bucks on propaganda and controls their own social media and attempts to control Ukraine's, America's, and western Europe's.>

Yes:

9JUL2024 State-Sponsored Russian Media Leverages Meliorator Software for Foreign Malign Influence Activity

The U.S. Federal Bureau of Investigation (FBI) and Cyber National Mission Force (CNMF), in partnership with the Netherlands General Intelligence and Security Service (AIVD), Netherlands Military Intelligence and Security Service (MIVD), the Netherlands Police (DNP), and the Canadian Centre for Cyber Security (CCCS), (hereinafter referred to as the authoring organizations) are releasing this advisory to warn social media companies that Russian state-sponsored actors have leveraged the covert Meliorator software for foreign malign influence activity benefiting the Russian Government. Affiliates of RT (formerly Russia Today), a Russian state-sponsored media organization, used Meliorator—a covert artificial intelligence (AI) enhanced software package—to create fictitious online personas, representing a number of nationalities, to post content on X (formerly Twitter). Using this tool, RT affiliates disseminated disinformation to and about a number of countries, including the United States, Poland, Germany, the Netherlands, Spain, Ukraine, and Israel.

Read details in the cybersecurity advisory
https://www.ic3.gov/Media/News/2024/240709.pdf

https://www.justice.gov/d9/2024-07/affadavit_for_968_x_accounts.pdf

https://www.justice.gov/d9/2024-07/affidavit_for_two_domains.pdf

3,670 posted on 07/10/2024 1:36:21 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 3668 | View Replies]

To: gleeaikin

Well put and well described.
Decades ago it took much more effort to make these kind of things happen, but now with the internet, it is so much easier.

Even a small group with relatively little funding can create havoc.

Just look at how lies like “good people”, “liars and suckers” , mansions, yachts, shopping trips,…. Spread like wild fire and even after proven false still exist in the ether.
Add to this the vastly easier ability to coordinate, communicate, and fund these operations and it is a mess.

Include withdugins work cloward-piven strategy and you can see this all coming together.

Think of this. It was Hilary who brought the reset button to Putin, Skolkovo, uranium 1jistnto name a few. The usuals come back with “ well Trump says he trusts Putin over his own intelligence agencies” and I would say to that me too, doesn’t mean Putin is more trustworthy just shows how corrupt our agencies have become.

If Trump was so friendly and sympathetic to Putin, why didn’t Putin invade Ukraine during his presidency. Many folks here and other places say things like Putin wouldn’t have invaded if Trump was president, but also say that if Trump is elected he will be soft on Putin and force a settlement that makes Ukraine cede land for peace.

Also remember it was Trump who said NATO countries were not spending enough on their own defense( think if they had how current situation might be better), sent actual arms to Ukraine, warned Europe about becoming more and more dependent on Russia for hydrocarbons, and pushed drill baby drill.

Another perhaps small item, but important at this time was Trump’s decision to reverse Obamas decision to destroy critically needed weapons stocks like cluster munitions

Additionally it was Trump who said putins “peace proposal” was unacceptable. Is that the guy you want to be negotiating with?

It is indeed very curious and dangerous times. Telling truth from lies is more difficult than ever. Anyone with access to a computer and the internet can creat chaos, like the yacht story by a guy with a few dozen followers, and “suddenly” major “news” sources and minims of smaller sources are blasting the ether with the story, or xiden is engaged, energetic and on top of things till….

Perhaps my favorite is the tactic of putting something in a head line, and having the story itself somewhere around paragraph 31 refute the headline. Recently many here and around the world made lots of hay saying “see
Putin wants peace he has proposed a plan…” and if the story actually covered his plan that amounts to Ukraine surrendering, giving Putin what he wants, and leaving Ukraine with no ability to defend itself it would be barely mentioned somewhere at the end of the story where get few take the time to read that far.

Since I am ranting I will add one more thing. Many tell us that nothing coming out of Russia is to be beleived, it is all propaganda…, but if RT plays clips of Trump and says Trump is their guy, well that is to be believed ???,


3,671 posted on 07/10/2024 3:53:36 AM PDT by blitz128
[ Post Reply | Private Reply | To 3666 | View Replies]

To: Chad C. Mulligan

“Hoplophobes”

That is a good one, never heard that before. Like many “phobes” they arnt really afraid of firearms, but what firearms in the hands of folks they don’t want can do with them

If you really wanted to decrease the instances of firearms used in criminal activity you would lock these people up and throw away the keys

Instead you use terms like “gun violence “ as if the inanimate object assets somekind of mystical abilities to control actions.

Like saying it was the SUV that ran people over


3,672 posted on 07/10/2024 4:03:22 AM PDT by blitz128
[ Post Reply | Private Reply | To 3667 | View Replies]

To: BeauBo

“Falling debris “ has become quite a problem for putin!


3,673 posted on 07/10/2024 4:04:32 AM PDT by blitz128
[ Post Reply | Private Reply | To 3664 | View Replies]

To: BeauBo

Would love to hear the discussions about how hitting Russian airbases(fro where the weapons and aircraft originate) is bad

Imagine fighting Germany in ww2 and not being able to hit luftwaffe bases inside Germany or the ability to target refineries

Hummmm


3,674 posted on 07/10/2024 4:08:09 AM PDT by blitz128
[ Post Reply | Private Reply | To 3660 | View Replies]

To: BeauBo

While that is all true, it is curious that with the US having some 50+ patriot systems, we have only given very few. Could France give more, definitely, could we give much more absolutely

How many patriots, abrams, Bradley’s, Strykers and F-16s do we have?

How many have we provided, how many F-16s(zero comes to mind).

lol remember when you point your finger at someone you are pointing 3 back at yourself.


3,675 posted on 07/10/2024 4:12:26 AM PDT by blitz128
[ Post Reply | Private Reply | To 3657 | View Replies]

To: SpeedyInTexas

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view. ]

The complete transcript.

[ Ukrainian Bradley Units Hunt Down And Erase Broken Russian Forces Amidst Deadly Minefields ]


Today [ July 9 ], there are a lot of updates from the Lyptsi direction.

Here, Ukrainians unleashed massive air strikes with guided bombs, both on Russian frontline targets and the Russian rear. Russians, losing their grip on Hlyboke, attempted a desperate mechanized assault on Ukrainians as Ukrainians advanced into the settlement.

While Ukrainians have little measures to defend against extensive Russian glide bomb strikes, the United States has provided Ukraine with western GBU-39 guided glide bombs to be able to hit back at Russian forces. The GBU-39 is a conventional bomb equipped with wings that extend the range of the bombs to a maximum of 110 kilometers by allowing them to glide through the air.

These wings are also programmable with GPS coordinates and laser guidance kits for precision strikes and circumventing Russian GPS jamming. Finally, these bombs were also delivered with specialized bomb racks that fit multiple bombs under one hard point, meaning Ukrainians can strike numerous targets at once.

However, Ukraine is not currently being provided with enough of these bombs to be able to launch constant strikes on the Russian military. Brigadier General Serhii Holubtsov said in an interview that to compensate, Ukraine is pursuing a domestic production of these bombs, noting that a Ukrainian variant is currently being developed and is being tested.

The United States and France have also, for a while now, supplied the Ukrainian air force with JDAM and AASM “Hammer” guided bombs, which Ukrainians have been using to strike Russian targets all over the front. Recently released geolocated footage shows a Ukrainian MiG-29 dropping two French AASM “Hammer” guided bombs on a Russian command post on the international border.

The Institute for the Study of War noted that due to the close proximity to the Kharkiv front, this command post was likely involved in overseeing and coordinating Russian offensive and defensive efforts in this direction.

Ukrainians also continued to monitor and drop more “Hammer” guided bombs on Russian positions in Hlyboke. Geolocated footage shows Russians moving into the buildings in the settlement before being destroyed by a Ukrainian air strike. Another video shows Ukrainians repeatedly hitting a Russian building with guided bombs till it fully collapsed.

Ukrainians also conducted a series of long-range strikes on the Kursk and Voronezh regions in Russia. In Kursk, a Russian military base was destroyed, which Russians used to reinforce their ongoing operations in northern Ukraine. While in Voronezh, Ukrainians struck another Russian ammunition warehouse and judging by the size of the rising smoke clouds; it was a big one, and Ukrainians had destroyed many shells and equipment.

Madyar’s Birds drone detachment also released an 18-minute video detailing their logistical strikes on the Russian supply lines. They reveal they had extensively mined Russian roads with drones and held them under FPV-fire control, destroying vast amounts of Russian reinforcements, supply trucks, and even some armored vehicles.

One short clip even shows how, on just one road, Ukrainians had destroyed over 18 Russian vehicles carrying infantry, ammunition, and other supplies.

Ukrainian soldiers note that because of the threat posed by Ukrainian mines and drones, Russians started avoiding the roads in favor of moving through forests and other green terrain.

Unfortunately for Russians, Ukrainians then promptly started mining the forests and tree lines, to great effect. As Ukrainian sappers in the area state, they can constantly hear these mines exploding throughout the day and night as Russians are moving toward and in between positions.

The combined and continued effort of striking Russian frontline and rear positions and severe damage to Russian logistics, put Ukrainians in an advantageous position to attack. Geolocated footage released by Russian units reveals that Ukrainians had launched a spearhead attack into Hlyboke.

Ukrainians broke through along the tree line, taking control over the river crossing and quickly enveloping the settlement to cut off Russian reinforcements.

Russian commanders realized that they were losing their grip on Hlyboke and ordered a desperate
mechanized assault to push Ukrainians back out of the the town.

Despite the high risk of losing their armored vehicles, Russians launched an attack consisting of 5 turtle tanks with mounted infantry on top as further reinforcements.

Ukrainians opened fire on the Russian assault with artillery destroying 3 of the turtle tanks as well as a platoon worth of infantry with cluster munitions, before they even came close to the settlement.

Realizing the breakout attempt had failed and not wanting to meet the same fate, the last
2 turtle tanks retreated back to the international border along with any infantry that survived the artillery bombardment. Ukrainian forces effectively used advanced western munitions distant mining and drone strikes to disrupt Russian logistics.

This weakened Russian combat capabilities and allowed Ukrainians to establish a foothold in Hlyboke repelling a desperate mechanized assault in the process. This underscores Ukrainian ability to create and capitalize on weaknesses in the Russian defense.

Ukrainians will also be able to continue these effective strikes as domestic production of glide
bombs comes online.


3,676 posted on 07/10/2024 4:26:37 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 3651 | View Replies]

To: SpeedyInTexas

Kremlin snuff box. 07/10/24
https://t.me/s/kremlin_secrets

There are rumors that Mikhail Teplinsky’s laurels haunt other generals

A week ago we wrote that thanks to systematic work under the command of General Mikhail Teplinsky, our troops managed to drive the enemy out of the village of Krynki in the Kherson region. It was a kind of bridgehead of the Ukrainian Armed Forces on the left bank of the Dnieper, and now it has been destroyed.

At the same time, our sources in the General Staff noted that it would be fair to reward Teplinsky. But the most interesting thing began after that.

A real campaign to discredit Teplinsky began in the General Staff itself and in the Ministry of Defense. A number of generals began to privately spread rumors about allegedly large losses of the Russian Armed Forces in Teplinsky’s area of ​​responsibility.

There is also information circulating in high offices that arrests are allegedly being prepared, if not of Teplinsky himself, then of someone from his close circle.

We urge you to stop attacks on a real military general! Mikhail Yuryevich is doing everything to bring our victory closer! And those who spread vile rumors should go to the front themselves, at least for a while!

If arrests become a reality, this will greatly demotivate the personnel.


3,677 posted on 07/10/2024 4:29:42 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 3651 | View Replies]

To: SpeedyInTexas

Kremlin snuff box, 07/10/24
https://t.me/s/kremlin_secrets

Our insight about missile attacks on Russia, unfortunately, is confirmed

Just a few days ago we wrote: NATO, after our successful strike on Kiev, can expand the enemy’s ability to strike deep into Russian territory. Including in Moscow. Unfortunately, this insight is confirmed.

The new British authorities said that the Kiev regime can fire British missiles at military targets on Russian territory.

“I don’t know whether the enemy will receive missiles that will reach Moscow. But NATO was not afraid, as we, frankly speaking, expected, and is pushing back the red lines. We’ll find out why we weren’t scared. Let’s see how events develop further,” the military man, who had previously predicted such problems, told us.

When asked whether a response to the West was being prepared, he refused to answer.

At the same time, another source, in the Ministry of Defense, expressed the hope that “the situation will not go too far, and at least NATO missiles will not fly to Moscow.”

We must once again appeal to all subscribers, and not only the military, with a request to be careful. The enemy is very cunning.

And, as we see, unfortunately, it is getting stronger.


3,678 posted on 07/10/2024 4:31:07 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 3652 | View Replies]

To: blitz128

RuZZia wants Trump to win.

China wants Biden to win.

Who can spread more disinformation?


3,679 posted on 07/10/2024 4:52:44 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 3656 | View Replies]

To: blitz128
Like many “phobes” they arnt really afraid of firearms, but what firearms in the hands of folks they don’t want can do with them

Dictionary definition says fear of the weapons themselves. As if a gun could leap from a drawer and kill someone, like a mad robot. I know people like that. Got one in the family even. Would leave the house hyperventilating if she saw my .22 revolver on the kitchen counter.

3,680 posted on 07/10/2024 5:48:41 AM PDT by Chad C. Mulligan
[ Post Reply | Private Reply | To 3672 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 3,641-3,6603,661-3,6803,681-3,700 ... 22,001-22,013 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson