Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

click here to read article


Navigation: use the links below to view more comments.
first previous 1-20 ... 22,261-22,28022,281-22,30022,301-22,32022,321-22,337 last
To: BeauBo; blitz128
DragonFire is a laser directed energy weapon designed and built entirely in the UK. It can hit a target the size of a £1 coin from a kilometre away, costs only £10 a shot, and just successfully took down a high-speed drone during testing.

https://x.com/DefenceHQ/status/1991483331892982192

17 s gif
https://www.gov.uk/government/news/boost-for-armed-forces-as-new-laser-weapon-takes-down-high-speed-drones

22,321 posted on 11/21/2025 1:43:46 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 22320 | View Replies]

To: Kazan; blitz128; AdmSmith; dennisw
When the war goes really badly (read peacefully), the Dimwit rushes here to the Ghetto and makes up his own reality. To face reality in a mature way is simply too painful for marginalized personalities


22,322 posted on 11/21/2025 3:03:13 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 22313 | View Replies]

To: JonPreston

22,323 posted on 11/21/2025 3:07:19 AM PST by dennisw (There is no limit to human stupidity / )
[ Post Reply | Private Reply | To 22322 | View Replies]

To: JonPreston
a man wearing a number 3 jersey is walking down stairs
22,324 posted on 11/21/2025 3:11:21 AM PST by dennisw (There is no limit to human stupidity / )
[ Post Reply | Private Reply | To 22322 | View Replies]

To: dennisw
angry Clown


To: JonPreston

Do this again and I will push the abuse button.

22,284 posted on 11/20/2025 7:59:34 AM PST by dennisw (There is no limit to human stupidity / )

22,325 posted on 11/21/2025 3:17:14 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 22324 | View Replies]

To: JonPreston

Idiot chile, you know to resize pics for the Free Republic format. So post normal size images or abuse button gets pushed.

A new sheriff is in town
Youse FR bad apples will be zotted by Chris Rob. To be replaced by conservative AI chat, that posts intelligent content. Equal to chatGPT, minus their lefty slant.

Chris Rob is sick n tired of your engagement farming spamming, your duped Putin hyping.
This will be done gradually. Kirrandyill will get the zot right after Pirate Poison Pen Preston. The other bad apples to follow. Go ask Chris Rob


22,326 posted on 11/21/2025 3:31:58 AM PST by dennisw (There is no limit to human stupidity / )
[ Post Reply | Private Reply | To 22325 | View Replies]

To: dennisw
post normal size images or abuse button gets pushed

Does Trump Peace Plan make Denny angry again today?


22,327 posted on 11/21/2025 3:48:05 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 22326 | View Replies]

To: gleeaikin
Just picture how much fun it is to hand wash dirty diapers, especially in winter. At least 77 years ago when I had to help my mother we had a primitive washing machine that swished the soap and diapers around, but then my job was to crank them thru rubber rollers to wring them out, while my mother drained the dirty water and put in fresh water twice for rinsing while I wrung them out twice more. She would hang them on the clothes line, but in winter they would be frozen stiff, and I would stack them up in a cool place where the moisture would gradually dissipate in the fresh air. We then had more clothes line to hang more laundry and eventually a pile of clean dry cloth diapers and clothes. Now that Russia has stolen most of the Washing machines, Ukraine’s women are back to that level too or worse.

Is why there were no women's gyms back then. No sweating to the oldies. No Rhumba. No zumba. No stairs machines. No yoga n Pilates.

Men never get any thank yous for washing machines, refrigerators, air fryers, VitaMix, microwave ovens, gas & electric stoves, sliced deli meats. Orville Redenbacher pre-buttered popcorn, Ghirardelli chocolates, shaved truffles on your spaghetti at swanky venues. So with so much free time on your hands you want to call *all* the shots. The under handed way you will do this is by getting excessive numbers of female judges appointed, by Democrats. And on the Federal level these are lifetime appointments. 55% of law school grads are women.

Female FedGuv judges block Trump agenda every day. This is the default for the Democrat appointed/

"Shaved truffles on spaghetti at a swanky restaurant typically cost around $40 to $60 or more, depending on the venue and the amount of truffle used. It's common for fine dining establishments to charge about $50 to $60 as an upcharge for shaved truffles added to pasta dishes, which matches your guess."

******* Your insatiable truffles are killing us.

22,328 posted on 11/21/2025 4:20:42 AM PST by dennisw (There is no limit to human stupidity / )
[ Post Reply | Private Reply | To 22314 | View Replies]

"Now that Russia has stolen most of the Washing machines, Ukraine’s women are back to that level too or worse."

Thank you gleeaikin.

As if I didn't need additional material to demonstrate how mental illness runs wild here in the Ghetto


22,329 posted on 11/21/2025 4:47:31 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 22314 | View Replies]

To: dennisw

That would be glorious. Those are the zots that will make me want to donate to FR again!


22,330 posted on 11/21/2025 6:32:17 AM PST by GBA (Endeavor to persevere … onward through the fog.)
[ Post Reply | Private Reply | To 22326 | View Replies]

To: dennisw; AdmSmith; PIF

Actually, 73 years ago I was in US gym classes where we changed into a gym suit to exercise, including sweat, engage in sports, and bring those uniforms home to wash once a week. What kind of backwards schools did your family attend 73 years ago? Sorry if this sounds confrontational, but you started it with all the ridiculous comments about women’s more recent activities.

Actually, I and other women appreciate the things men have invented for our use so they will have more comfort and we will have more time for sex, but you probably do not appreciate what women have invented. It is likely that in many areas it was women who invented sewing, pottery making, fabric and cooking millennia ago.


22,331 posted on 11/21/2025 6:44:32 AM PST by gleeaikin (Question Authority: report facts, and post their links in your message.)
[ Post Reply | Private Reply | To 22328 | View Replies]

To: gleeaikin
Actually, I and other women appreciate the things men have invented for our use...

Many inventions and discoveries were made by women but the men got credit for it. Rosalind Franklin was not recognized for decades for her discovery of the DNA structure. More recently Earle Hass is recognized for inventing tampons but it was a woman in California (of course, California) who first invented an insertable tampon.

22,332 posted on 11/21/2025 7:12:46 AM PST by ladyjane
[ Post Reply | Private Reply | To 22331 | View Replies]

"It is likely that in many areas it was women who invented sewing, pottery making, fabric and cooking"

don't forget daytime TV.

22,333 posted on 11/21/2025 7:13:53 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 22331 | View Replies]

To: SpeedyInTexas

You actually read what it wrote?


22,334 posted on 11/21/2025 7:15:18 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 22307 | View Replies]

To: gleeaikin

However, it is quite possible that Xi is now less interested in attacking Taiwan, and looking at reoccupying lands that were once Chinese, but later taken by Russia.


Now both taking land in Russia and Taiwan look far more doable and appealing since 47 signaled that Invasion Pays, Baby!


22,335 posted on 11/21/2025 7:22:03 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 22314 | View Replies]

To: SpeedyInTexas

Sounds like serious, high pressure negotiations.

The Russians open with maximal demands as always.

But the reason they are seriously engaged, is because they now have to be, to avoid the imminent destruction of their oil revenue and infrastructure, by Trump’s sanctions and Ukraine’s upgunned strike capability.

At a minimum, they want to deflect long enough to get through Winter.


22,336 posted on 11/21/2025 7:23:08 AM PST by BeauBo
[ Post Reply | Private Reply | To 22303 | View Replies]

To: ladyjane

Actually Haas never invented the tampon. He invented an applicator. He got a patent for the applicator but never could get manufacturers interested so he sold the patent to a woman who founded the Tamax company.


22,337 posted on 11/21/2025 7:24:08 AM PST by ladyjane
[ Post Reply | Private Reply | To 22332 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 22,261-22,28022,281-22,30022,301-22,32022,321-22,337 last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson