Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 0putinsfolly; 0putinswar; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynow; anydaynowputinwins; anydaynowrussiawins; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; jonputinbot; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 22,161-22,18022,181-22,20022,201-22,22022,221-22,229 next last
To: PIF

More of that Russian disinformation debunked:

Kyiv Post (17 Nov):

“Reports circulated Monday claiming that Rustem Umerov – the former defense minister now serving as secretary of Ukraine’s National Security and Defense Council (NSDC) – had stayed abroad to avoid a looming defense probe by the country’s anti-graft agency.

However, a government-affiliated agency quickly dismissed the claims.

Multiple outlets, including the Turkish-based account Clash Report, claimed on Monday that Umerov had “refused to return to Ukraine” amid the corruption scandal surrounding businessman Timur Mindich – a longtime associate of President Volodymyr Zelensky.

According to those reports, Umerov had allegedly told Zelensky he would not return and had abruptly departed for Turkey under the pretext of negotiating prisoner exchanges...

...In an official statement, the CCD (Ukraine’s Center for Countering Disinformation) said the allegations circulating online do not correspond to reality.

The CCD said Umerov is on a planned official trip to the US, not Turkey, as of Monday for a series of high-level consultations aimed at strengthening international support for Ukraine, adding that Umerov is in constant contact with Ukraine’s leadership and continues to oversee key matters of security, defense and humanitarian policy.”


22,181 posted on 11/17/2025 6:35:54 PM PST by BeauBo
[ Post Reply | Private Reply | To 22156 | View Replies]

To: BeauBo
"Young Churchill"


22,182 posted on 11/18/2025 2:29:59 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 22180 | View Replies]

To: dennisw; AdmSmith

22,183 posted on 11/18/2025 2:43:02 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 22177 | View Replies]

To: BeauBo
What the hell is wrong with NATO?


22,184 posted on 11/18/2025 3:27:22 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 22183 | View Replies]

To: BeauBo

Just being the disrupter it has always admitted to being, latest juvenile pics/memes are not displaying 😂😂


22,185 posted on 11/18/2025 4:31:26 AM PST by blitz128
[ Post Reply | Private Reply | To 22180 | View Replies]

To: PIF; BeauBo; blitz128; gleeaikin; Dot; adorno; Timber Rattler; dennisw; marcusmaximus; ETCM
Russian Offensive Campaign Assessment, November 17, 2025

Russian forces may be attempting to fix Ukrainian forces within Pokrovsk itself while also encircling Ukrainian forces in the Pokrovsk-Myrnohrad pocket from the west, likely because Russian forces have found such an encirclement more feasible than an encirclement from the east. Elements of the Russian 2nd Combined Arms Army (CAA, Central Military District [CMD]) and 51st CAA (formerly 1st Donetsk People's Republic Army Corps [DNR AC], Southern Military District [SMD]) are attempting to close the encirclement of the pocket from the southwest and northeast of Pokrovsk, respectively, but are each struggling to concentrate forces and make significant advances. The 51st CAA is fighting in two directions that are not mutually supportive because the CAA is simultaneously trying to advance north of Pokrovsk, close the encirclement, and reduce the pocket around Pokrovsk. This split focus is likely hindering the 51st CAA’s efforts to close the Ukrainian pocket, consistent with Russian forces’ pattern of pursuing different objectives in an operational direction rather than concentrating efforts on a single decisive objective.[1] SMD elements northeast of Pokrovsk are simultaneously attempting to attack in multiple directions, particularly around Dobropillya. Elements of the 51st CAA are attacking southwestward to seize Rodynske (north of Pokrovsk) to close the encirclement. Russian naval infantry elements, likely operationally subordinated to the neighboring Russian 8th CAA (SMD), are attacking southeast of Dobropillya toward Sofiivka and Novopavlivka.[2] Ukrainian forces have been counterattacking the base of the Dobropillya salient from the west and east, likely to blunt Russian attacks in the area to advance north.[3] Ukrainian military observer Kostyantyn Mashovets reported that elements of the Russian 114th and 132nd motorized rifle brigades (both of the 51st CAA) counterattacked along the Zapovidne-Ivanivka line (southeast of Dobropillya) and the Mayak-Nove Shakhove line (east of Dobropillya), likely to defend against these Ukrainian counterattacks.[4]

Russian forces likely initially seized on an opportunity to advance in the Dobropillya direction in part to portray Russian forces as making significant advances ahead of the August 2025 Alaska summit, but the resulting vulnerabilities from failing to make operationally significant advances in the area may be hindering Russian efforts to complete the encirclement of the Pokrovsk pocket at this time.[5] A Russian milblogger acknowledged at the height of the Dobropillya effort in August 2025 that the base of the Russian penetration was too narrow to develop stable logistics, making the salient vulnerable to Ukrainian counterattacks.[6] Elements of the 51st CAA have since deprioritized the Dobropillya effort to focus on collapsing the Pokrovsk pocket, but the 51st CAA must now divide its attention between advancing northeast and north of Pokrovsk while still defending against Ukrainian counterattacks in the Dobropillya direction that now threaten Russia's near rear on the eastern flank of Pokrovsk.[7]

The 2nd CAA is also struggling to concentrate sufficiently to close the pocket from the southwest. Mashovets reported that elements of the 2nd CAA attacked near Udachne and Kotlyne (both southwest of Pokrovsk), indicating that the 2nd CAA is dispersing its offensive efforts to both close the Ukrainian pocket from the west as well as to advance within Pokrovsk and north from the town.[8] Mashovets assessed that Russian forces are attempting to fix Ukrainian forces within Pokrovsk and Myrnohrad (east of Pokrovsk) to prevent Ukraine from conducting an orderly withdrawal that would negate the potential operational impact of the future Russian seizure of Pokrovsk. The 2nd CAA has made speedier advances within Pokrovsk and on the western flank of the pocket than the 51st CAA has made on the eastern flank, but has failed to seize Pokrovsk and collapse the pocket at this time since rapidly infiltrating into the town in late October 2025.[9] Russian forces fighting in the Pokrovsk direction have taken some of the highest losses on the battlefield in recent months, and elements of the 51st and 2nd CAAs are likely degraded as they attempt to complete the seizure of Pokrovsk and Myrnohrad.[10] ISW continues to assess that Russian forces will very likely complete the seizure of Pokrovsk and Myrnohrad, though the timing and operational implications of these seizures remain unclear at this time.

Russian forces may attempt to use vehicles to transport troops, likely under the cover of fog, in order to speed up the clearing of Pokrovsk itself. Mashovets assessed that Russian forces are specifically clearing the T-0504 Novoekonomichne-Myrnohrad and O0544 Hrodivka-Myrnohrad roads (both east of Myrnohrad) to allow vehicle-borne Russian soldiers to enter Myrnohrad.[11] ISW previously assessed that Russian forces are using the cover of fog that inhibits Ukrainian drone operations to transport troops into Pokrovsk.[12] Mashovets stated that the continued Ukrainian presence in northern Pokrovsk is forcing small Russian infantry groups in the area to fight under conditions of a sub-tactical encirclement in the area, while the Ukrainian forces remaining south of the Donetska Railway in Pokrovsk are fighting in similar conditions. The inability of Russian small group infiltration tactics to generate sufficient mass to clear Ukrainian forces within Pokrovsk presently will likely force Russian forces to resort to using vehicles during inclement weather conditions to transport large numbers of troops into Pokrovsk.

Russia is reportedly continuing to struggle to replace its battlefield losses with new recruits. Russian opposition outlet Vazhnye Istorii reported on November 17 that Russian federal budget expenditure data shows that 262,700 people signed contracts with the Russian Ministry of Defense (MoD) and received one-time sign-up bonuses between January and September 2025 — an average of roughly 29,189 new recruits per month.[13] The Ukrainian General Staff reported that Russian forces suffered about 28,400 to 48,000 losses per month between January and September 2025.[14] The data from the Ukrainian General Staff indicates that Russian forces suffered an average of roughly 35,400 losses per month — more than the reported average monthly recruitment rate. Russia's main method for generating manpower through high financial incentives and price surging has reportedly been losing momentum and hitting diminishing returns in recent months.[15] ISW continues to assess that Russia's recent law on the deployment of active reservists within Russia and occupied Ukraine is part of wider efforts to set conditions to deploy involuntarily called up active reservists to combat operations in Ukraine in an effort to offset these decreasing recruitment rates.[16]

Saboteurs recently damaged at least two segments of a Polish railway on a route to Ukraine. Polish police reported that a train conductor observed damage to a portion of the Lublin-Warsaw railway line near Życzyn, Poland on the morning of November 16.[17] Polish Prime Minister Donald Tusk stated on November 17 that an explosion from an act of sabotage destroyed portions of the Lublin-Warsaw railway line near Mika and Lublin.[18] Polish authorities have not attributed the explosions to a specific actor as of this writing. Investigative journalist Christo Grozev published images of a damaged rail track near Warsaw and an electrical cable laid across the track on the route to Rzeszów.[19] Grozev assessed that the cable was 300 meters long and led to a nearby parking lot, allowing a saboteur to remotely detonate an explosive device. It is unclear whether this incident on the Warsaw–Rzeszów railway line is connected to the incidents on the Warsaw-Lublin line. The Lublin-Warsaw and Warsaw–Rzeszów railway lines support Western military assistance deliveries to Ukraine.[20] The rail line explosions come against the backdrop of Russia's intensifying “Phase Zero” campaign to destabilize Europe, undermine NATO's cohesion, and set the political, informational, and psychological conditions for a potential future Russian war against NATO.[21]

France agreed to sell Ukraine weapons systems, such as fighter jets and air defense systems. Ukrainian President Volodymyr Zelensky and French President Emmanuel Macron signed a declaration of intent on November 17, allowing Ukraine to purchase military equipment from France.[22] Zelensky reported that the document will allow Ukraine to purchase 100 Rafale F4 fighter aircraft by 2035, radars for air defense systems, air-to-air missiles, aerial bombs, and eight SAMP/T air defense systems with six launchers each. The document calls for technology transfers and joint production of Rafale aircraft in Ukraine. Zelensky stated that the Ukrainian and French defense industrial bases (DIBs) will begin joint production of interceptor drones and work to develop components for Ukrainian drones in 2025.[23] Ukrainian Foreign Minister Dmytro Kuleba told CNN on September 3 that only US-made Patriot systems and French- and Italian-made SAMP/T air defense systems can intercept Russian ballistic missiles.[24]

https://understandingwar.org/research/russia-ukraine/russian-offensive-campaign-assessment-november-17-2025/

22,186 posted on 11/18/2025 5:46:34 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 22131 | View Replies]

To: BeauBo; blitz128
The name of a high-ranking Russian official, on whom the saboteurs planned an assassination attempt, became known

Recently, the media reported on the exposure of a sabotage group that was going to assassinate a high-ranking Russian official. His name was not disclosed. As it became known to MK, the assassination attempt was being prepared on the Secretary of the Security Council of the Russian Federation Sergei Shoigu.
https://www.mk.ru/politics/2025/11/17/stalo-izvestno-imya-rossiyskogo-chinovnika-na-kotorogo-planirovali-pokushenie-diversanty.html

Кремлевская табакерка

Shoigu, after the assassination attempt, does not rule out that he will return to the post of Minister of Defense

This was reported to us by several sources close to the Secretary of the Security Council. “Everyone already knows that the saboteurs wanted to kill Sergei Shoigu. Such desires of the enemy can hardly be considered accidental. The target turned out to be one of the most experienced and important politicians in Russia. And we all must understand: it is good that Sergei Shoigu has not yet said his last word in the history of our country,” one of them is sure.

According to another associate of Shoigu, he does not rule out that he may again take the post of Minister of Defense, because under Andrei Belousov, “the army has not achieved great success.” And the assassination attempt may push Vladimir Putin to return Sergei Shoigu to his previous position. After all, it “shows the significance” of the Secretary of the Security Council for Russia. It should be noted that this is not the first time that Shoigu has announced his desire to retake the post of Minister of Defense. Earlier, his attempts to replace Belousov were unsuccessful.

https://t.me/kremlin_secrets/6434

22,187 posted on 11/18/2025 6:12:02 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 22161 | View Replies]

To: Thunder90; BeauBo; blitz128
Кремлевская табакерка
18NOV2025
Not just Kaliningrad. Gerasimov reveals plans for the Baltic states

There has been increasing talk in Europe about the possibility of direct military confrontation with Russia. One of the possible flashpoints is said to be the Baltic states, with Russia potentially using force to create a corridor to the Kaliningrad region.

We have previously written about the existence of such plans on paper. This is no big secret. In response to the words of German Defense Minister Pistorius, who stated the possibility of direct military conflict with Russia as early as 2028-2029, we were contacted by people close to General Gerasimov. They asked us to publish the following statement.

“Kaliningrad is Russian territory. In response to various provocations and attempts at blockade in the Baltic Sea, the Russian Armed Forces reserve the right to respond harshly,” said the channel's source. He emphasized that this is not only about creating a corridor to Kaliningrad, but also about the possibility of regaining control over the Baltic countries, including Poland.

“Modern warfare is very different from how the art of war is currently perceived in Europe. It is a whole complex of various measures and long-term campaigns,“ the source said, stressing that this includes information campaigns, which the Chief of the General Staff wrote about in his famous ”Gerasimov Doctrine” back in 2013.

https://t.me/kremlin_secrets/6436

22,188 posted on 11/18/2025 6:26:19 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 22187 | View Replies]

To: blitz128

Like so many others perverted by homosexuality, like assassins Thomas Crooks and Tyler Robinson, and horrific psycho killers like John Wayne Gacy or Jeffery Dahmler, debasing himself and disgracing his family with filth has likely unmoored him from any real connection to goodness or the divine, leaving him to twist the self-hatred that he earned, into a pathological relationship with others.

A personality crippled by the wages of sin.


22,189 posted on 11/18/2025 6:48:59 AM PST by BeauBo
[ Post Reply | Private Reply | To 22185 | View Replies]

To: AdmSmith

Truly Bone-Crushing Sanctions are now working. Urals oil is selling below its breakeven price, and quantities are crashing suddenly.

OilPrice.com (18 Nov):

“China’s imports of oil from Russia and Iran are set to drop this month as importers and refiners are more careful and still devise workarounds after the U.S. stepped up sanctions on Russia’s oil exporters and on China’s terminals that are key import hubs for sanctioned Iranian crude.

Imports from Russia could drop by up to 800,000 barrels per day (bpd) in November compared to the levels before the U.S. sanctions on Rosneft and Lukoil, according to estimates by Rystad Energy cited by Bloomberg. Due to a separate set of U.S. and EU sanctions on China’s key import terminals for Iran’s oil, Chinese imports of crude from Iran could drop by about 30% in November from previous months, Rystad Energy reckons.

China’s state-owned majors including Sinopec and PetroChina have canceled previously ordered Russian oil cargoes, and large state and private refiners are looking for alternative supply in the short term.”


22,190 posted on 11/18/2025 7:10:46 AM PST by BeauBo
[ Post Reply | Private Reply | To 22188 | View Replies]

To: BeauBo; blitz128; LowIQ
🍈

😂😂😂😂

🤡

Here's your Young Churchill, Melon Man😂


22,191 posted on 11/18/2025 7:20:03 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 22189 | View Replies]

To: AdmSmith

If You Still Believe That Russia Started This Conflict in 2022, Then You Are Ignorant, or Brainwashed.

The END to NATO.

The Ukraine war, which I will argue was provoked by the West and especially the United States.

This war will be settled on the battlefield where the Russians are likely to win an ugly victory.

Settling the war diplomatically is not possible because the opposing sides have irreconcilable differences.

Instead, it’s likely to be, as I said, an ugly victory, where Russia ends up occupying somewhere between 20 to 40% of pre-2014 Ukraine, while Ukraine ends up as a dysfunctional rump state covering the territory that Russia does not conquer.

Ukraine has effectively been wrecked. It has already lost a substantial portion of its territory and is likely to lose more land before the fighting stops.

Russian leaders recognized that the Ukrainian army, which was larger than the invasion force, I want to emphasize this, the Ukrainian army was larger than the Russian invasion force, it was armed and trained by NATO, and it was becoming a de facto member of NATO.

Immediately after the war began, Russia, not Ukraine, Russia reached out to Ukraine to start negotiations to end the war and work out a modus vivendi between the two countries. This move is directly at odds with the claim that Putin wanted to conquer Ukraine and make it part of greater Russia.

Negotiations between Kiev and Moscow began in Belarus just four days, four days after the Russian invasion. And that Belarus track was eventually replaced by an Israeli as well as an Istanbul track. The available evidence indicates that the Russians were negotiating seriously and were not interested in absorbing Ukrainian territory, save for Crimea, which they had annexed in 2014, and possibly the Donbass region.

The negotiations ended when the Ukrainians, with prodding from Britain and the United States, walked away from the negotiations, which were making good progress at the time. The Russians did not walk away from the negotiations.

In the months before the war started, Putin tried to find a diplomatic solution to the brewing crisis. On 17 October 2021, remember the war begins February 2022, this is 17 December 2021, Putin sends letters to both President Biden and to NATO Chief Jens Stoltenberg proposing a solution to the crisis based on a written guarantee that does three things.

Number one, Ukraine would not join NATO, number two, no offensive weapons would be stationed near Russia’s borders, and number three, NATO troops and equipment moved into Eastern Europe since 1997 would be moved back to Western Europe.

Whatever one thinks of the feasibility of reaching a bargain based on Putin’s opening demands, it shows he was trying to avoid war.

The United States, on the other hand, refused to negotiate with Putin. It appears it was not interested in avoiding war.

In fact, the United States and its European allies provoked the war.

Bringing Kiev into the European Union and promoting a color revolution in Ukraine, you all remember the Orange Revolution, which was designed to make Ukraine a pro-Western liberal democracy, are the other two prongs of the policy.

Russian leaders across the board said repeatedly before the war. that they considered NATO expansion into Ukraine to be an existential threat that had to be eliminated.

Putin made numerous public statements laying out this line of argument before 24 February, 2022.

Other leaders, including the defense minister, the foreign minister, the deputy foreign minister, and Moscow’s ambassador to Washington also emphasized the centrality of NATO expansion for causing the crisis over Ukraine.

Sergei Lavrov, the foreign minister, made this point succinctly at a press conference on 14 January, 2022.

Lavrov says “’The key to everything is the guarantee “’that NATO will not expand eastward.’

Substantial number of influential and highly regarded individuals in the West recognized before the war that NATO expansion, especially into Ukraine, would be seen by Russian leaders as a mortal threat and eventually would lead to disaster.

William Burns, who was recently Joe Biden’s head of the CIA, but he was the American ambassador to Moscow in April 2008 when the decision was made to bring Ukraine and Georgia into NATO, wrote a very famous memo that I’m sure some of you are familiar with to then Secretary of State Condoleezza Rice. This is a quite remarkable memo, and I’m going to quote extensively from it. “’Ukrainian entry into NATO is the brightest “’of all red lines for the Russian elite, not just Putin. “’In more than two and a half years of conversations “’with key Russian players, from knuckle draggers “’in the dark recesses of the Kremlin “’to Putin’s sharpest liberal critics, “’I have yet to find anyone who views Ukraine and NATO “’as anything other than a direct challenge “’to Russia’s interests.’ “’NATO,’ he said, quote, “’would be seen as throwing down the strategic gauntlet. “’Today’s Russia will respond. “’Russian-Ukrainian relations will go into a deep freeze. “’It will create fertile soil for Russian meddling “’in Crimea and Eastern Ukraine.’”
This was written by Bill Burns in 2008. Burns was not the only Western policymaker in 2008 who understood that bringing Ukraine into NATO was fraught with danger.

Both Angela Merkel, who was then the German chancellor, and French President Nicolas Sarkozy adamantly opposed moving forward to bring Ukraine into NATO.

Merkel said, “’I was very sure that Putin is not going “’to just let that happen.”’From his perspective, that would be a declaration of war.’”

Putin saw Ukraine joining NATO as a mortal threat that could not be allowed and was willing to go to war to prevent it from happening, which he did, of course, in February of 2022.

Relations between Europe and Russia will not only be poisonous, they will also be dangerous. The possibility of war will be ever-present.
In other words, the threat of a major European war will not go away when the fighting in Ukraine stops.

Russian victory in Ukraine, would be a stunning defeat for Europe. Or to put it in slightly different words, it would be a stunning defeat for NATO, which has been deeply involved in the Ukraine conflict since it started.

The political fights, some will question the future of NATO, given that it failed to check Russia, the country that most European leaders describe as a mortal threat.

Threats to the EU aside, the great reduction in the flow of gas and oil to Europe since the war started has seriously hurt the major economies of Europe and slowed down growth in the overall Eurozone.

General Observations
The Ukraine war has been a disaster.
It has had catastrophic consequences for Ukraine.
It has poisoned relations between Europe and Russia for the foreseeable future.
It has made Europe a more dangerous place.
It has also caused serious economic and political harm inside Europe, and badly damaged transatlantic relations.

Most European leaders, and I’m sure most people in the various European publics, will blame Putin for causing the war, and thus for its terrible consequences. But they are wrong. The war could have been avoided if the West had not decided to bring Ukraine into NATO, or even if it had backed off from that commitment once the Russians made their opposition clear.

Had that happened, Ukraine would almost certainly be intact today within its pre-2014 borders, and Europe would be more stable and more prosperous. Crimea would still be part of Ukraine.

***Professor John J. Mearsheimer, the R. Wendell Harrison Distinguished Service Professor of Political Science at the University of Chicago and a globally recognized expert in international relations.


22,192 posted on 11/18/2025 7:26:14 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 22151 | View Replies]

To: AdmSmith

And the similarities continue to nazi germany, nazis wanted the Polish corridor and Soviet Union 2.0 wants the Kaliningrad corridor🤔


22,193 posted on 11/18/2025 7:27:22 AM PST by blitz128
[ Post Reply | Private Reply | To 22188 | View Replies]

To: AdmSmith; dennisw; SpeedyInTexas; PIF

President Trump’s new sanctions on Rosneft and Lukoil have demolished Russian oil revenue. A mushroom cloud-like destructive effect. Nothing gradual about it. It is looking like a combination of the Urals price collapsing below breakeven, and the loss of about 2 Million barrels per day of sales (so far). Rystad projects 800,000 bpd less to China in November, and Indian refineries moving away quicker.

OilPrice.com (18 Nov):

Reliance Snaps Up Kuwaiti Crude as India Shuns Sanctioned Russian Oil

“Reliance has been a major buyer of crude from the Middle East and Russia in recent years. After the U.S. sanctions on Russia’s top oil firms Rosneft and Lukoil last month, the Indian refiner snapped up millions of barrels of crude from the Middle East as it said it would comply with the Trump Administration’s sanctions.

Reliance, which operates the world’s biggest refinery complex at Jamnagar with 1.4 million barrels per day (bpd) of processing capacity, has a long-term deal with Rosneft to buy almost 500,000 bpd. Reliance was India’s single biggest buyer of Russian crude, until now.

Reliance typically does not import crude from sanctioned entities and is unlikely to risk secondary U.S. sanctions by continuing imports from Rosneft, as the Indian conglomerate is a listed entity with access to the U.S. banking system, sources familiar with the company told the Financial Times at the time.

Even before the U.S. sanctions were announced, Reliance had accelerated crude oil purchases from the Middle East and had been more active than usual in procuring oil from the Gulf region.

All but two Indian refiners have skipped placing orders for Russian crude for December after the U.S. sanctioned Rosneft and Lukoil, sources with knowledge of the purchases told Bloomberg last week.”


22,194 posted on 11/18/2025 7:31:21 AM PST by BeauBo
[ Post Reply | Private Reply | To 22190 | View Replies]

To: boo
oh boy


22,195 posted on 11/18/2025 7:33:22 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 22194 | View Replies]

To: BeauBo
Day 1,362 of the Muscovian invasion. 960 [average is 851] i.e. more than 40 Russians, Norks and Cubans/h.


22,196 posted on 11/18/2025 7:46:30 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 22132 | View Replies]

To: AdmSmith


22,197 posted on 11/18/2025 7:57:16 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 22196 | View Replies]

To: JonPreston
*******

A Week Long Drone Fight Which Russia Is Winning

Over the last seven days the Ukrainian military has launched over one thousand drones against targets in Russia. Most of these were shot down by Russian air defenses. There are no reports of any serious damage.

The biggest effect the week long drone attacks achieved was to shut down air traffic in Moscow for several hours.

After waiting a few days the Russian military responded in kind.

Over the last three days a record number of drones and missiles were launched against military installations and production facilities in Ukraine (archived):

Russia stepped up missile-and-drone assaults on the Ukrainian capital of Kyiv and other regions, killing at least 12 people overnight into Sunday after President Trump last week declined to impose further sanctions on Moscow over its refusal to halt its invasion.

Russia attacked with a total of 367 drones and missiles—one of the largest single-night raids of the war, according to the Ukrainian Air Force—in a second consecutive day of pounding strikes that sent civilians running for shelters in the middle of the night.

Over three days the Russian forces used some 1,000 heavy drones plus 58 cruise- and 31 ballistic-missiles to attack Ukraine.

The Russian attacks are overwhelming (archived) the western provided air defenses:

https://t.me/s/kremlin_secrets

What did Avdiivka cost us? Truly scary numbers have become known

The capture of Avdiivka and further advance on this section of the front is the largest victory of the Russian army over the past year.

The military command was in a hurry to drive the Ukrainian Armed Forces out of there before the March Presidential elections. It was expected that Vladimir Vladimirovich would even record a video with Avdiivka in the background (but later this idea was abandoned).

A secret report on the results of the battles for Avdiivka came into our hands. It is worth noting that the city, like a bone in the throat, prevented the alignment of the front, and the Ukrainian Armed Forces had the opportunity to shoot at Donetsk from there, including using cannon artillery.

From November 1, 2023 to March 1, 2024, in Avdiivka and on the approaches to it, our army lost:
➖ 14,453 dead
➖ 1,267 are listed as missing
➖ 42,312 were injured and/or amputated

[ Total casualties lost in the taking of Avdiivka: 58,032. A 3:1 ratio would give >19,000 dead. ]

The scale of losses in technology is also known. In the battles for Avdiivka our troops lost:
➖ 242 tanks
➖ 384 armored vehicles
➖ 312 artillery systems

Sergei Shoigu has these figures. He also reported to Vladimir Putin about the capture of the city, but then there was no definitive data. Obviously, Shoigu is in no hurry to report such colossal losses in technology.

The President previously took the loss of equipment in the Northern Military District very hard.

Why are we publishing this information? There are several questions regarding Avdiivka.

The main one is that another destroyed city will not bring anything to the budget in the coming years, and we have already spent huge amounts of money on its capture (and still have to invest in restoration).

Also, in the battles for the city, almost 60,000 military personnel were killed or injured.

••And these are only those who could be counted.••

Perhaps our command’s tactics need to be adjusted? We really hope that there will be people around Vladimir Vladimirovich who will talk about the real scale of the tragedy in Avdiivka.

22,198 posted on 11/18/2025 7:58:02 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 22197 | View Replies]

To: JonPreston
Reporting From Ukraine:
Note: other versions of this report are found elsewhere on FR, but this is guaranteed to be the complete transcript - unlike the others.
https://www.youtube.com/@RFU

[ Terrible Miscalculation. Russians Realized The Forest Battle is no Walk in The Park ]

==

JUST IN: Chicago Mayor Brandon Johnson wishes everyone "happy Africa Day."

"Happy Africa Day, everyone!" pic.twitter.com/UiZC8fY8y4— Eric Daugherty (@EricLDaugh) May 26, 2025


22,199 posted on 11/18/2025 7:58:35 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 22198 | View Replies]

On February 2, President Volodymyr Zelensky of Ukraine said he had only received $75 billion of the $175 billion the United States had spent on Ukraine.

******

22,200 posted on 11/18/2025 7:59:24 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 22199 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 22,161-22,18022,181-22,20022,201-22,22022,221-22,229 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson