Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 0putinsfolly; 0putinswar; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynow; anydaynowputinwins; anydaynowrussiawins; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; jonputinbot; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 22,041-22,06022,061-22,08022,081-22,10022,101-22,110 next last
To: BeauBo

Want to read a youtube video quicky. Find the transcript button. Copy and paste into chatGPT or perplexity. Tell them to remove timestamps, format it nicely to 65-70 pixels word wrap.

I just did this above for Peter Zeihan video


22,081 posted on 11/16/2025 3:12:16 AM PST by dennisw (There is no limit to human stupidity / )
[ Post Reply | Private Reply | To 22077 | View Replies]

To: dennisw

“Ukraine has been stockpiling drones and missile for the cold months”

That has been my suspicion, and indeed what I assess as most likely, based on reports that I have seen. Especially the heavy hitters, with the big payloads, like Flamingo and Long Neptune.

However, I don’t think that a big plan coordinated with NATO would focus effects for Christmas, in and of itself. I can see the political/social impact of such an effect, but I really expect the timeline to be driven by the brass tacks physics of Winter cold, and Christmas to be a more coincidental by product.

By Orthodox Christmas however, I do expect that the flamingoes will have hit the fan, and crisis (perhaps blackouts and fuel shortages) will be apparent to all.


22,082 posted on 11/16/2025 3:26:51 AM PST by BeauBo
[ Post Reply | Private Reply | To 22079 | View Replies]

To: dennisw

Amazing.

They say that the AI that we see today, is the worst that we will ever see, for the rest of our lives - it will get even better quickly.


22,083 posted on 11/16/2025 3:29:39 AM PST by BeauBo
[ Post Reply | Private Reply | To 22081 | View Replies]

To: BeauBo
Putin has brought the Doom upon Russia. Poverty. Food coupons. The 1990#, all over again.

At least you have enough sense to stay off the main pages and stick with Speedy's crummy thread. We all appreciate that.

22,084 posted on 11/16/2025 3:46:41 AM PST by Right_Wing_Madman
[ Post Reply | Private Reply | To 22075 | View Replies]

To: Right_Wing_Madman; PIF; BeauBo; blitz128; gleeaikin; Dot; adorno; Timber Rattler; dennisw; ...

22,085 posted on 11/16/2025 4:01:53 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 22084 | View Replies]

To: BeauBo

This winter will be hard on Ukraine, little doubt of that with no signs of pitin relenting, however this winter may very well be the watershed moment for the Russian people and it’s economy.

For almost 4 years the hinterlands of the Russian federation have suffered the most for the wannabe czar, but the chickens are coming home to roost for moscow and St. Petersburg.

Energy and money are keys to pitin’s power, and both are failing.

I may be wrong, but Ukraine has been able to weather the attacks on its infrastructure and energy grid, however I don’t think Russia has the same ability to survive a concentrated attack on theirs.

If major attacks on energy grid occur, and I think they will, the effects will be long term and devastating, not only on the Russian people, but on pitin’s grip on power.

That grip on power is what is sustaining this war, and that grip is waning


22,086 posted on 11/16/2025 4:16:13 AM PST by blitz128
[ Post Reply | Private Reply | To 22063 | View Replies]

To: JonPreston

Here is another one of the corrupt, little dictator’s “projects.”

Zelensky has said that he wants to be “remembered as the president who built good roads.” 😂😅😂🤣

https://www.kyivpost.com/post/7415


22,087 posted on 11/16/2025 4:36:49 AM PST by ANKE69 (The fact that I am Jewish barely makes 20 in my long list of faults" Zelensky in 2019 )
[ Post Reply | Private Reply | To 22085 | View Replies]

To: BeauBo

AI

January is the coldest month of the year in Moscow, with average daily temperatures typically ranging from about -6°C to -10°C and nights that can be colder, especially around the middle and later parts of the month. Around January 20—the period traditionally regarded as the peak of winter cold—average daily temperatures are generally between -3°C (high) and -10°C (low), but occasional cold snaps can drop nighttime temperatures even further, sometimes below -20°C during exceptional years.​


22,088 posted on 11/16/2025 4:39:20 AM PST by dennisw (There is no limit to human stupidity / )
[ Post Reply | Private Reply | To 22082 | View Replies]

To: gleeaikin

Short clip with another example of how pitin’s Russia and nazi germany are alike
The nazis had the “Jewish problem”, and the Russians have the “Ukrainian problem”

https://m.youtube.com/shorts/oByayWZNRHw


22,089 posted on 11/16/2025 4:45:52 AM PST by blitz128
[ Post Reply | Private Reply | To 22064 | View Replies]

To: dennisw

The idea that there is corruption in Ukraine is nothing new, and frankly unsurprising considering who they learned it from, and needs to be addressed, just like the massive corruption within the US needs to be.

Massive Russian corruption hardly needs to be discussed as it is widely known and apparently accepted by pitinistas, however the effects of this corruption is about to hit the average Russian very hard


22,090 posted on 11/16/2025 4:56:57 AM PST by blitz128
[ Post Reply | Private Reply | To 22088 | View Replies]

To: PIF; BeauBo; blitz128; gleeaikin; Dot; adorno; Timber Rattler; dennisw; marcusmaximus; ETCM
Russian Offensive Campaign Assessment, November 15, 2025

Russian forces used weather conditions to exploit vulnerabilities in Ukraine's drone-based battlefield defenses in the Novopavlivka direction, highlighting Ukraine's need for traditional weapons systems. Geolocated footage published on November 14 shows Ukrainian forces striking Russian armored vehicles in northeastern Novopavlivka.[1] A Russian milblogger claimed that Russian forces reached Novopavlivka's northwestern outskirts during the mechanized assault.[2] Ukrainian volunteer Serhii Sternenko reported on November 15 that Russian forces took advantage of poor weather conditions to enter Novopavlivka several times with equipment and land infantry.[3] Sternenko stated that Russian forces set up a pontoon bridge between Yalta (south of Novopavlivka) and Dachne (east of Yalta) and moved about 10 pieces of equipment across the Vovcha River.[4] Sternenko stated that Ukrainian forces detected the Russian forces too late but struck two tanks and five infantry fighting vehicles (IFVs). Russian milbloggers also reported on Russian forces’ use of heavy fog during the assault and claimed that Russian forces were able to cross the pontoon bridge twice.[5] One milblogger noted that Russian forces were able to use the second wave of the attack to send in reinforcements to support the troops that dismounted after the first wave.[6] A Russian milblogger credited elements of the Russian 80th Tank Regiment (90th Tank Division, 41st Combined Arms Army [CAA], Central Military District [CMD]) with conducting the mechanized assault.[7]

Russian forces have recently been exploiting foggy weather to attack throughout the front, particularly in the Pokrovsk, Velykomykhailivka, and Hulyaipole directions.[8] The Novopavlivka sector of the front has been relatively quieter in recent weeks, as Russian forces have been concentrating on offensive operations to seize Pokrovsk and close the Pokrovsk-Myrnohrad pocket. Elements of the 41st CAA, whose area of responsibility (AoR) covers the Novopavlivka direction, have notably been supporting elements of the 2nd CAA (CMD) on the southern flank of Pokrovsk.[9] The November 14 company-sized mechanized assault into Novopavlivka after a lull in the area demonstrates how Russian forces are trying to find opportunities to exploit a key weakness in Ukrainian defenses — the inability of Ukrainian drones to effectively function in poor weather conditions like fog and rain. Ukraine has thus far in the war based its defense on drones largely out of necessity. Ukraine's “wall of drones” defensive barrier uses a large number of tactical strike drones and loitering munitions to destroy Russian manpower and equipment on the front line.[10] Ukrainian forces adopted this defensive approach in part to offset manpower and equipment shortages while protecting over 1,200 kilometers of front line from Russian advances. Sparsely held Ukrainian defensive positions have facilitated recent Russian infiltration efforts, and shortages of artillery and other traditional systems have limited Ukrainian forces’ ability to operate when bad weather disrupted some drone operations.[11] Western provisions of traditional systems like artillery are key to Ukraine's ability to build out a layered defense system that is not dependent on any one type of weapon, such that the defenses are vulnerable and exploitable. Russia's exploitation of this vulnerability further highlights the way that traditional weapons systems are not obsolete in modern warfare.

Ukrainian forces appear to be trying to replicate Russia's battlefield air interdiction (BAI) campaign on a limited scale. The Ukrainian 7th Rapid Reaction Corps of the Air Assault Forces reported on November 15 that Ukrainian forces conducted an airstrike against the M-30 road that runs between Pokrovsk and Selydove (southeast of Pokrovsk in the Russian near rear).[12] The corps reported that the airstrike impeded Russian forces from using the route to infiltrate Pokrovsk with light equipment. Geolocated footage of the strike published by the 7th Corps shows that Ukrainian forces struck the M-30 between Pokrovsk and Novopavlivka (just southeast of Pokrovsk).[13] Russian forces notably recently advanced into Pokrovsk on motorcycles, buggies, and transport trucks along the M-30 under heavy fog.[14] The Ukrainian Eastern Group of Forces reported on November 14 that the Ukrainian Air Force struck a Russian transport communications facility and a Russian manpower concentration near Shevchenko (south of Pokrovsk in the Russian near rear) with a GBU-62 Joint Direct Attack Munition-Extended Range (JDAM-ER) guided bomb.[15] A Ukrainian source reported on November 14 that Ukrainian forces also conducted a strike with a GBU-62 bomb against a road bridge in occupied Zaporizhia Oblast that Russian forces used for logistics.[16]

Russian forces have spent months conducting a strike campaign that achieved partial BAI efforts to shape the battlefield and set conditions for Russia's recent advances in the Pokrovsk, Velykomykhailivka, and Hulyaipole directions.[17] The limited Ukrainian strikes targeting Russian ground lines of communication (GLOCs) and force concentrations are a step toward denying Russia the relative sanctuary that Russian forces have enjoyed in near rear areas.[18] A dramatically expanded Ukrainian BAI effort could disrupt the operations of the current Russian offensive approach. Russia's BAI campaign notably began months before the recent intensification of offensive operations on the ground, however, and Ukraine should similarly work to incorporate BAI efforts into its longer-term campaign design.

Russia's large-scale production of glide bombs and Shahed-type drones will continue to facilitate Russia's BAI campaign on the front. Ukrainian Main Military Intelligence Directorate (GUR) Deputy Chief Major General Vadym Skibitskyi told Reuters in an article published on November 14 that Russia plans to produce up to 120,000 glide bombs in 2025, including 500 of the longer-range glide bomb variants that can fly up to 200 kilometers.[19] Reuters noted that the 120,000 figure includes both new glide bomb production and the modernization of existing unguided bombs into guided versions. Skibitskyi stated that Russia is working to further modify the bombs to fly up to 400 kilometers. Skibitskyi reported that Russian forces have recently been launching 200 to 250 glide bombs daily — a sharp rise from an average of 170 per day in October 2025. Skibitskyi noted that Ukrainian forces can shoot down glide bombs, but that the quantity Russia is currently using is “enormous.” Skibitskyi also reported that Russia will make about 70,000 long-range drones in 2025, including 30,000 Shahed-type drones. Skibitskyi's report is largely in line with GUR Spokesperson Colonel Andriy Yusov’s statement in early September 2025 that Russia can produce 2,700 Shahed-type drones per month.[20] ISW observed that Russia began using modified glide bombs with extended ranges of 100 to 180 kilometers against Ukrainian cities in October 2025.[21] Glide bombs have been integral to Russia's BAI campaign in the Kursk, Kostyantynivka, Dobropillya, Pokrovsk, Velykomykhailivka, and Hulyaipole directions.[22] Russian forces have also begun to use Shahed drones to strike targets in the immediate and near rear areas as Russia's Shahed production increased dramatically over Spring-Summer 2025. Russian forces have augmented their tactical drone campaign against Ukrainian ammunition depots and fortified defensive structures with guided glide bombs and Shahed drone strikes as these weapons deliver larger payloads than tactical drones, allowing Russian forces to target fortified structures.

North Korea continues to provide military support to Russia and may be preparing to provide Russia with drones in the future. Skibitskyi told Reuters that Russian forces were able to maintain their rate of fire on the battlefield in 2024 thanks to artillery shell shipments from North Korea, but that North Korean stocks have run low, such that North Korea halved the number of shells it sent to Russia in 2025.[23] Skibitskyi stated that North Korea has sent a total of 6.5 million shells to Russia since 2023. North Korea reportedly did not deliver any ammunition to Russia in September 2025 but resumed shipments in October 2025. Russia reportedly had to ship about half of the delivered shells to plants for improvements since the shells were old. Skibitskyi noted that North Korea has started mass production of short-range first-person view (FPV) drones and medium-range strike drones on North Korean territory. ISW observed reports on November 14 that Russia is planning for roughly 12,000 North Korean workers to join the Alabuga Special Economic Zone (ASEZ) in the Republic of Tatarstan by the end of 2025 to work at Russia's factory producing Shahed-type drones — likely in addition to the 25,000 workers that North Korea was reportedly considering sending to the ASEZ in June 2025.[24] Thousands of North Koreans learning how to assemble Shaheds will offer North Korea valuable lessons about large-scale production of modern long-range strike drones, and North Korea may be cooperating with Russia to produce various types of drones in North Korea for Russia in the face of dwindling North Korean artillery shell stores.

Russian forces continue their BAI campaign against Ukrainian railway infrastructure, seeking to disrupt Ukrainian rear logistics hubs to facilitate battlefield gains. Ukrainian Deputy Prime Minister Oleksiy Kuleba told The Guardian in an article published on November 15 that Russian forces have increased their strikes against Ukraine's rail system threefold since July 2025.[25] Kuleba noted that Russian forces have struck railway infrastructure 800 times since January 2025, damaging more than 3,000 objects and totaling one billion dollars’ worth of damage. Kuleba added that Russia's strike campaign has three objectives: to destroy Ukrainian logistics in the south to prevent the movement of goods such as Ukrainian grain to seaports; to disrupt rail traffic to cut off frontline oblasts; and to ”destroy everything” in Donetsk and Luhansk oblasts. Head of Ukraine's railway operator Ukrzaliznytsia, Oleksandr Pertsovskyi, added that Russian forces use Shahed-type drones to target individual locomotives. The station head of a rail station in Lozova, Kharkiv Oblast reported that Russian forces targeted Lozova as it is a major junction that connects to Dnipro City, Slovyansk, Poltava City, and Kharkiv City. ISW previously reported that Russian forces have been using modified Shahed-type drones equipped with a thermal imaging camera and a video stream to pursue moving targets, such as trains, in real time in Chernihiv and Sumy oblasts.[26] Russia recently intensified its BAI efforts against rail infrastructure to disrupt Ukraine's use of its intermediate rear area for logistics, particularly along the E-40 Izyum-Slovyansk highway (about 20 to 35 kilometers from the frontline) and T-0514 Dobropillya-Lyman highway (about 14 to 30 kilometers from the front line) — both critical arteries that supply Ukraine's fortress belt in Donetsk Oblast.[27]

Russia's long-range drone and missile strike tactics are precisely targeting gas infrastructure in Ukraine during the heating season. Ukrainian state-owned gas enterprise Naftogaz Chief Executive Serhii Koretskyi told the New York Times (NYT) in an article published on November 15 that Russia began to strike Ukrainian gas infrastructure in 2025 after Ukraine halted the transport of Russian gas to Europe on January 1, 2025.[28] Koretskyi reported that Naftogaz spent the summer of 2025 repairing gas infrastructure that Russian forces struck at the end of Winter 2024-2025 when Russia knocked out about 40 percent of Ukraine's gas production capacity. The NYT noted that Russian forces renewed these strikes in October 2025, and a European official source stated that Russian forces struck Naftogaz’s facilities seven times in October 2025, knocking out 60 percent of Ukraine's gas production capacity. Ukrainian Internal Affairs Minister Ihor Klymenko reported that Russia knows the location of Ukraine's gas infrastructure as it dates back to Soviet times. Koretskyi noted that Russian missile and drone strikes cannot reach Ukraine's underground gas storage facilities, but that Russia is striking the compressor pumps that pump the gas from underground and the pipelines that distribute gas throughout the country. Russian forces’ targeting of specific types of Ukrainian gas infrastructure demonstrates the sophistication of their strike campaigns with the explicit goal of complicating living conditions for Ukrainian civilians in the wintertime.

Russia appears to be setting conditions to deploy involuntarily called up reservists to occupied Ukraine, likely in an effort to commit them to combat operations. Ukrainian Luhansk Oblast Head Oleksiy Kharchenko reported on November 15 that the Russian Ministry of Defense (MoD) gathered the first group of involuntarily called up active reservists as part of Russia's recent initiative to covertly mobilize and deploy reservists to protect critical infrastructure.[29] Kharchenko stated that the Russian MoD sent the active reservists to training centers to train for two months. Russia's recent law on active reservists calls for their deployment to areas of Russia, and ISW continues to assess that Russia may attempt to send active reservists to areas of occupied Ukraine as the Kremlin defines the four illegally annexed oblasts in Ukraine as part of Russia.[30] Russian state business outlet Kommersant reported on November 10 that Russia plans to use reservists in oblasts that border Ukraine to combat Ukrainian sabotage and reconnaissance groups, evacuate populations, and support “counterterrorism” operations; and may use this legal language to deploy active reservists to areas of occupied Ukraine that border unoccupied oblasts in Ukraine.[31]

Russian forces continue to boast about executing Ukrainian servicemembers. The far-right Russian paramilitary unit Rusich Sabotage Assault Reconnaissance Group acknowledged on its Telegram channel on November 15 that it executed three Ukrainian servicemembers in an unspecified area of the front.[32] Ukrainian military observer Yuriy Butusov reported that Rusich Group leader Alexei Milchakov — who is a self-proclaimed Nazi — is serving within the 417th Reconnaissance Battalion of the 42nd Motorized Rifle Division (58th Combined Arms Army [CAA], Southern Military District [SMD]).[33] ISW last observed reports of the battalion operating in western Zaporizhia Oblast in late October 2025.[34] Butusov reported that the execution occurred near Pokrovsk, however, but noted that Russian milbloggers have complained that Milchakov and the Rusich Group do not participate in combat operations but engage in propaganda activities in the rear. The Rusich Group's public acknowledgement of its war crimes is in line with ISW’s long-held assessment that the Russian military command is endorsing and sometimes ordering war crimes on the battlefield.[35]

https://understandingwar.org/research/russia-ukraine/russian-offensive-campaign-assessment-november-15-2025/

22,091 posted on 11/16/2025 6:04:57 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 22042 | View Replies]

Day 1,360 of the Muscovian invasion. 860 [average is 851] i.e. more than 35 Russians, Norks and Cubans/h. Vehicles and fuel tanks more than 35% above average


22,092 posted on 11/16/2025 6:05:04 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 22043 | View Replies]

To: blitz128

“Ukraine has been able to weather the attacks on its infrastructure and energy grid, however I don’t think Russia has the same ability to survive a concentrated attack on theirs.”

Ukraine has an “extension cord” to receive electricity to its grid from its neighbors. I have seen a report that claimed that no other country is wired to send electricity to Moscow, but I would think that Belarus could send some to neighboring parts of Russia.


22,093 posted on 11/16/2025 6:09:40 AM PST by BeauBo
[ Post Reply | Private Reply | To 22086 | View Replies]

To: PIF; BeauBo; blitz128
Кремлевская табакерка

14NOV2025: There are more and more internal enemies of Russia in the Kremlin, the situation is becoming dangerous

Such a statement was made and asked by a high-ranking source in the Presidential Administration to publish it. “At a time when our guys are heroically fighting at the front, moving forward, despite terrible losses, there are more and more supporters among the elites of the speedy completion of the NWO, stopping hostilities without any Victory. You see, they don't like war and crisis. And now many are hysterical because of the severe restrictions on the Internet, which are being prepared for next year. Weaklings and traitors!” - the channel's interlocutor shared the information and was indignant.

He noted that he did not just give us this data. “I constantly warn, but many do not hear me. Internal enemies are becoming more and more numerous almost everywhere – including in the Kremlin. They are still hiding, but they can manifest themselves at any time. And they need to be dealt with! The situation is becoming dangerous, and enemies and conciliators can arrange anything - up to an attempt on Vladimir Vladimirovich! We need a reaction!” the source believes. Several other sources in the Presidential Administration told Human Rights Watch that the situation is not so difficult and tragic. But they admit that there are indeed more supporters of the early completion of the NWO in the Kremlin.

https://t.me/kremlin_secrets/6418

22,094 posted on 11/16/2025 6:18:30 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 21967 | View Replies]

To: blitz128
The idea that there is corruption in Ukraine is nothing new, and frankly unsurprising considering who they learned it from, and needs to be addressed, just like the massive corruption within the US needs to be.

Russia is spreading the bs about Ukrainian corruption being so awful that it is a waste of time for the US to help out Ukraine. You see the FReepers here going about Ukraine's corruption. They are regurgitating Russian talking points and propaganda that they prolly got second hand.

I am saying that they did not pick this stuff up from a neutral publication. RT puts this trash out there.

- - - - -

RT
https://www.rt.com
RT - Breaking News, Russia News, World News and Video
RT is the first Russian 24/7 English-language news channel which brings the Russian view on global news.
World News
RT delivers latest news on current events from around the world including …
Rumble Player
RT’s flagship, award-winning English-language channel airs 24/7 from the …
Live
RT provides an alternative perspective on major global events, and acquaints an …
Russia
Find news on the Russian economy, politics, and wider society, as well as …
Israel Strikes Iran
Israel carried out a series of strikes on Iran in the early hours of Friday, …
Where to watch
RT TV Channel is available in North America, South America, Europe, …

22,095 posted on 11/16/2025 6:18:59 AM PST by dennisw (There is no limit to human stupidity / )
[ Post Reply | Private Reply | To 22090 | View Replies]

To: PIF; blitz128; BeauBo
Кремлевская табакерка

14NOV2025
Veterans of the SVO will be obliged to have special numbers on cars

At the suggestion of the Minister of Internal Affairs Kolokoltsev, the government is discussing the possibility of creating special car numbers in Russia, which will be issued exclusively to veterans of the SVO. “This is a great honor. And it is important that others understand who is next to them,” the Ministry of Internal Affairs explained. It is also expected that special places will be created in public parking lots.

At the first stage, the issuance of special numbers will be carried out at the request of the owners themselves, but in the future it is possible that the presence of such numbers will be mandatory. At the same time, the Ministry of Defense has not yet commented on such an initiative, although our interlocutors hinted at the opposite effect - this idea needs to be properly worked out in terms of security for the veterans themselves and their families.

https://t.me/kremlin_secrets/6419

A good idea, it makes it easier to seize cars after the war.

22,096 posted on 11/16/2025 6:23:04 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 22094 | View Replies]

To: blitz128

Short clip with another example of how pitin’s Russia and nazi germany are alike
The nazis had the “Jewish problem”, and the Russians have the “Ukrainian problem”
____________________

Nazis gave Jews the Holocaust. Russians/Stalin gave Ukraine its own Holocaust, by a forced famine called Holodomor, with 3 million Ukrainians starved to death.


22,097 posted on 11/16/2025 6:23:27 AM PST by dennisw (There is no limit to human stupidity / )
[ Post Reply | Private Reply | To 22089 | View Replies]

To: dennisw

Nazis gave Jews the Holocaust.


Stalin helped, he purposely didn’t defend the areas of the Soviet Union where most of their Jews lived, knowing Hitler would take care of his Jewish problem.


22,098 posted on 11/16/2025 6:25:41 AM PST by dfwgator ("I am Charlie Kirk!")
[ Post Reply | Private Reply | To 22097 | View Replies]

To: dennisw
Кремлевская табакерка

14NOV2025 Putin does not understand how the military missed the strike on Novorossiysk

The enemy struck Novorossiysk at night, including the Sheskharis oil terminal. The consequences are serious, of course, we will not disclose them. The situation infuriated Vladimir Putin. “Vladimir Vladimirovich does not understand one thing. The day before, he demanded that the military say when the successful strikes on our oil facilities for the enemy will stop. And immediately such shelling, with such losses, a blow was missed. The president's patience, you know, can run out. The military must better protect important facilities. I hope they will finally understand this,” a source in the Kremlin told us.

He does not rule out that if the situation does not change in the near future, the president may take serious steps. In particular, to make several tough personnel decisions. Another representative of the Presidential Administration said that “the situation in Novorossiysk turned out to be so unpleasant that even the strike on Kiev did not bring Vladimir Vladimirovich such joy as usual.”

https://t.me/kremlin_secrets/6420

22,099 posted on 11/16/2025 6:28:29 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 22095 | View Replies]

To: BeauBo
Ukraine has an “extension cord” to receive electricity to its grid from its neighbors. I have seen a report that claimed that no other country is wired to send electricity to Moscow, but I would think that Belarus could send some to neighboring parts of Russia.

8FEB2025 The three Baltic states on Saturday cut ties with Russia's power grid to join the European Union's network, the culmination of a years-long process that gained urgency with Moscow's invasion of Ukraine.

Estonia, Latvia and Lithuania — all former Soviet republics that are now in the European Union and NATO — had wanted to block Russia's ability to geopolitically blackmail them via the electricity system. “We have removed any theoretical possibility of Russia using energy (grid) control as a weapon,” Lithuanian Energy Minister Zygimantas Vaiciunas told AFP on Saturday. The European Commissioner for Energy, Dan Jorgensen, said: “This is indeed a historic day.”

https://www.themoscowtimes.com/2025/02/08/baltic-nations-switch-off-russian-power-grid-a87916

22,100 posted on 11/16/2025 6:46:01 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 22093 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 22,041-22,06022,061-22,08022,081-22,10022,101-22,110 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson