Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

click here to read article


Navigation: use the links below to view more comments.
first previous 1-20 ... 20,441-20,46020,461-20,48020,481-20,50020,501-20,508 last
To: AdmSmith; SpeedyInTexas

What an amazing depletion of Russia’s tank inventories!

Out of all of their T-80s and T-90s, only about 100 hangar queens remain.

Amazing. Russia is simply no longer a tank power.

At over 1,300, Greece can field more tanks today, than Russia. For Turkey, 2,200.

Poland only had a few hundred in 2022 (after their donations to Ukraine), but their Defense buildup is now well into the delivery stage, with 110 new Korean K2 Black Panther tanks already delivered from Korea, and Polish domestic production of theK2 to begin in part next year (full rate by 2028j.

Production of new M-1 Abrams tanks for Poland began last year, and they are on track to receive 250 by the end of next year. They also have Germany producing Leopards for them. All of the above.

At a minimum, they would have 1,600 top of the line tanks in the field in 2030 (assuming no significant losses), but they now seem likely to well overshoot that target.


20,501 posted on 10/08/2025 8:36:25 AM PDT by BeauBo
[ Post Reply | Private Reply | To 20495 | View Replies]

To: BeauBo
At over 1,300, Greece can field more tanks today, than Russia. For Turkey, 2,200. (Poland) 1,600...

Yes, but how many donkeys can they field? How about Golf carts and motorcycles?

Russia's artillery advantage has also been seriously reduced, if not eliminated/reversed. Air defenses too.

20,502 posted on 10/08/2025 11:13:51 AM PDT by ETCM (“There is no security, no safety, in the appeasement of evil.” — Ronald Reagan)
[ Post Reply | Private Reply | To 20501 | View Replies]

To: mir; big; stupid
🍈✌ ☮️

“The Truth Is Coming Out”… Russian President’s Special Envoy: Biden “Provoked the War in Ukraine to Cover Up His Family’s Corruption”

https://t.co/fs1xwTXULX— Tony Seruga (@TonySeruga) October 8, 2025


20,503 posted on 10/08/2025 11:27:53 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 20496 | View Replies]

To: ETCM

121 days till pitin matches length of “great patriotic war” against former ally Nazi germany🤔


20,504 posted on 10/08/2025 11:30:26 AM PDT by blitz128
[ Post Reply | Private Reply | To 20502 | View Replies]


20,505 posted on 10/08/2025 11:31:04 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 20503 | View Replies]

The US and Israel are pushing a ceasefire which lacks detail and masks myriad pitfalls. Here's what a serious negotiation would look like.
Analysis | Middle East
  1. regions middle east
  2. israel-gaza

In Deir al-Balah, a mother told me her son now counts the seconds between blasts. Policy, to her, isn’t a debate; it’s whether trucks arrive and the night is quiet. Donald Trump’s 20-point plan promises ceasefire, hostages home, Israeli withdrawal, and reconstruction. It sounds complete. It isn’t.

Without enforceable mechanics, maps, timelines, phased verification, and real local ownership; it risks being a short-lived show, not a durable peace.

On paper, the plan strings together familiar parts: a ceasefire tied to hostage releases, withdrawal linked to disarmament, and a multinational stabilization effort to guard rebuilding. Used well, those tools can buy civilians time to breathe: a tranche-based exchange that releases hostages as pauses begin and expands aid corridors with each verified step; and a properly mandated, regionally backed stabilization presence that keeps fighters away from families, protects convoys, and secures reconstruction sites so hospitals, schools, and water systems can function. Modest instruments, not magic, but correctly sequenced, they save lives.

The design breaks down where hard agreements usually do. First, it effectively treats disarmament as surrender, demanding that an armed actor relinquish leverage before credible political guarantees and security protections exist. Durable settlements don’t start with a leap of faith over a void.

Second, the withdrawal language is vague. If a “pullback” arrives bundled with continuing perimeter control, airspace, crossings, or security carve-outs, residents will experience it as occupation under a new brand. Independent analysis notes the text lacks concrete timelines and operational granularity past the opening phase.

Third, enforcement leans on statements rather than machinery. Without mapped guarantor responsibilities, triggerable penalties, and pre-positioned logistics, promises turn into press releases. Reporting on the Palestinian Authority’s potential role underscores how preconditions and sequencing could stall implementation.

There’s a deeper political absence, too. This deal does not deliver what Palestinians actually hope for: self-determination and a say in their future. After high-profile recognitions of Palestinian statehood, offering a Gaza-only fix that sidelines political rights makes those gestures look symbolic rather than substantive. Having Israeli institutions effectively able to veto consequential steps feels like Oslo all over again: process without power-balancing.

That is how interim arrangements harden into permanent limbo — deference to political will instead of instruments, asymmetric leverage left intact, and verification without consequences. Analyses of the current proposal also point to how leaders can convert hesitation into de facto veto power.

If Trump is serious about peace, Jerusalem and the West Bank must be inside the plan, not promised to some later round. Facts on the ground are moving the other way. The UN Security Council has said settlements lack legal validity and violate international law. The UN humanitarian office has documented widespread settler violence and access restrictions that corrode daily life and any negotiated horizon.

Independent Israeli media and NGOs describe accelerating de facto annexation trends. A plan that ignores this landscape will not produce the security it promises.

I don’t say this as a spectator. For three decades, and, crucially, from 1994 to 2012, I worked across Israel and the Palestinian territories, running dialogues, designing confidence measures, and trying to push fragile agreements into daily reality. I arrived at Oslo believing its interim architecture could be saved. Hard experience taught me why it often wasn’t: interimism without enforcement calcifies; asymmetry invites spoilers; and externally driven programs that sideline local voices manufacture the very grievances violence feeds on. Those are not laments; they’re operating instructions.

So what would a plan that acts like peace look like? Start with measured, verifiable sequencing. Convert the hostage-for-ceasefire idea into a tranche ladder with objective indicators.

Tranche 0: a 72-hour humanitarian pause and release of the most vulnerable hostages, independently verified.

Tranche 1: further releases and sustained relief corridors.

Tranche 2: armor out of GPS-mapped grid squares; municipal functions transferred to neutral civil administrators.

Tranche 3: localized arms-reduction pilots paired with trained community policing.

Tranche 4: broader demobilization tied to political benchmarks. Publish indicators per tranche, names returned, coordinates vacated, tonnage of aid delivered, verified hand-ins, police trained, on a public dashboard so guarantors act on facts, not spin.

Next, replace applause with commitments on paper. Regional states and major donors should sign a concise guarantor treaty with annexes that spell out who does what when breaches occur: logistics deployed within 48 hours, escrowed funds released or frozen, proportionate sanctions, or a rapid-response element under hybrid command.

Add an escalation ladder, a dispute-resolution clause, and a small guarantor secretariat that tracks readiness daily. Tie money to verification outcomes so incentives are immediate and reversible. Established policy work already frames these sequencing and governance choices—use it to draft the legal plumbing.

Then give monitoring real teeth. Stand up a Verification & Rapid Response Authority (VRRA) with three pillars: a Technical Verification Unit (remote sensing, forensics, chain-of-custody); a Civilian Observers Network (local monitors and NGO liaisons); and a Rapid Response Wing (pre-positioned transport, medevac, engineering). When the VRRA issues an evidence packet—geolocated imagery, metadata, documented hand-ins—it should automatically trigger the agreed guarantor response. Monitoring that cannot cause action is theater; people in Gaza do not have time for theater.

Demobilization must not be coerced by a vacuum. It should be gradual, conditional, and reversible — and paired with a transitional political compact that guarantees participation, association, and a mapped route to representation. Pilot DDR alongside livelihoods, public hiring, micro-grants, reconstruction jobs—and community-led policing reforms so neighborhoods feel safer, not abandoned. Field reporting shows that sequencing PA governance and security responsibilities will make or break feasibility; treat that as a design constraint, not a footnote.

Reconstruction must rebuild institutions, not patronage. Create a Donor Compact & Reconstruction Authority (DCRA) with pooled escrow and a multistakeholder board, Gaza municipalities, West Bank civil society, donors, independent auditors, and a VRRA liaison. Use digitized public procurement, local-first contracting, community sign-off on major projects, and payments contingent on VRRA-verified delivery. Coverage of an Arab-backed multibillion-dollar plan illustrates how donor politics can fragment; a compact like DCRA keeps money honest and visible to the people it is meant to serve.

Finally, coherence or collapse: a Gaza-only fix will not hold. Pair Gaza tranches with West Bank protections, temporary settlement constraints tied to compliance, increased international monitoring at checkpoints, and targeted support for communities under strain, because what happens in one arena cascades into the other.

If negotiators want something immediate and practical to insist on, here it is: redraft the plan into a tranche protocol with mapped withdrawals and a public verification dashboard; sign the guarantor treaty and pre-position logistics and escrow, with an explicit escalation ladder; and stand up the VRRA and DCRA with legal charters, independent boards, and automatic triggers so verification leads to action, not statements.

Gaza’s families don’t need grandeur; they need a night without terror, a clinic with light, a school bell that rings. Recognitions of Palestine should mean voice and agency, not just new communiqués. A plan that looks like peace but acts like control will fail them. Put Jerusalem and the West Bank inside the deal. Build the scaffold, measured tranches, mapped withdrawals, independent verification, accountable reconstruction, and you buy time for politics, dignity for civilians, and a future Palestinians can recognize as their own.


Top photo credit: President Donald Trump walks out with Steve Witkoff after taking part in bilateral meetings at the United Nations Headquarters in New York City, Tuesday, September 23, 2025. (Official White House Photo by Daniel Torok)
Analysis | Middle East
Top image credit: screen grab via https://www.youtube.com/@RealTime

Van Jones found out: Gaza dead baby jokes aren't funny

Media

On Friday, Van Jones joked about kids dying in Gaza.

“If you open your phone, and all you see is dead Gaza baby, dead Gaza baby, dead Gaza baby, Diddy,” Jones said on Bill Maher’s ‘Real Time’ HBO program.

“That’s basically your whole feed,” Jones said.

The audience laughed and applauded.

The CNN host came off as dismissive of these deaths, calling it a “disinformation campaign” on behalf of Iran and Qatar.

The backlash on social media was fierce, where users made clear that the bloodshed in Gaza was very real and not mere “disinformation.”

Progressive pundit Briahna Joy Reid wrote, “Turning ‘dead Gaza baby’ into a punchline is such an evil choice that I'm struggling to even engage with the outrageous lie that we only care about Gazan deaths because of an Iranian social media campaign.”

The Yaqeen Institute’s Omar Suleiman shot back, “Truly disgraceful and vile (Van Jones). I’m sorry dead Gaza babies bother you so much. Maybe tell the people paying you to put lipstick on a genocide to stop killing them.”

The Quincy Institute’s Trita Parsi said Jones’ comments were a blueprint for how pro-Israel elites try to censor “what is actually happening in Gaza: A genocide of children conducted by Israel and defended by plenty of folks in the US, many of them on Israel's payroll.”

NBC News’s Hola Gorani reacted in a post, “I've watched hundreds of hours of Gaza videos in the last 2 years, including content filmed by our brave teams inside the strip, and can confirm that the ‘dead Gaza baby’ images are quite real, not the product of a ‘disinformation campaign’ and that there is nothing funny about them.”

Media critic Sana Saeed might have summed it up best, “The reason Van Jones can get up, use ‘dead Gaza babies’ so crassly, toss in a joke about Diddy mid-sentence, and have an audience erupt in laughter - without hesitation for either context or content - is because of the depth and breadth of dehumanization that’s been permitted toward Palestinians…There is no America in which ‘dead Jewish babies’ could ever be invoked in such a vulgar way on such a platform.”

On Sunday, Jones apologized. Twice. Jones also turned off X replies to his apology.

This did not stop people from replying.

Democratic Senator Chris Van Hollen perhaps best summarized how many received Jones apology, “I’m glad Van Jones apologized for his sick joking about dead kids in Gaza.”

“But the problem goes deeper: he spread Netanyahu propaganda that the mass killings of civilians in Gaza—including 20K+ kids—is Iranian fake news,” the senator added.

“It’s not the students and young people who are fooled. It’s Van Jones,” Van Hollen said.

The senator is right. A recent poll showed a whopping 41 percent of Americans now call the actions of Israel’s government in Gaza a “genocide.” Another poll showed that in December 2023, 69 percent of Americans believed U.S. support for Israel was in their country’s national interest. Last month, that support for Israel had dropped to 47 percent.

To Van Hollen’s point, younger Americans are increasingly less supportive of Israel.

The mass killing of Palestinians, including children, is not something millions of Americans and the world are merely imagining due to foreign propaganda campaigns of Van Jones’ imagination. The deaths are real, the internet exists, and people are seeing this carnage in real time thanks to modern technology.

And as humanity demands, they are horrified by it.

It’s that simple. No one is making this up. If I included every negative reaction to Jones in the last 48 hours this column could become a novel.

Jones' comments on Friday night came almost literally at the same moment President Donald Trump hailed on X that “Israel has temporarily stopped the bombing in order to give the Hostage release and Peace Deal a chance to be completed.”

Whether Israel actually implemented a ceasefire or Trump’s plan is viable are separate questions. But that even the president acknowledges the ongoing Israeli war on Gaza is key.

This is no fantasy, Van Jones. It’s certainly no joke.

What’s important, and perhaps the lesson to be learned by this controversy, is that pro-Israel elites simply denying the most massive slaughters of human beings in the Middle East this century is no longer viable.

Americans have eyes. Hearts, too.

keep readingShow less
Top image credit: Frederic Legrand - COMEO, Joey Sussman, miss.cabul via shutterstock.com

Why Trump won't get Afghanistan's Bagram base back

Middle East

In a September 20 Truth Social post, President Trump threatened the Taliban, declaring, “If Afghanistan doesn’t give Bagram Airbase back… BAD THINGS ARE GOING TO HAPPEN!!” He now wants the military base he once negotiated away as part of the U.S. withdrawal agreement his first administration signed in 2019.

Not unexpectedly, the Taliban quickly refused, noting “under the Doha Agreement, the United States pledged that ‘it will not use or threaten force against the territorial integrity or political independence of Afghanistan, nor interfere in its internal affairs.’” And with China now deeply entrenched in post-war Afghanistan, it’s likely Beijing will ensure that the threat remains little more than another off-the-cuff comment that should not be taken literally nor seriously.

Since early 2025, Trump has mentioned Bagram, not as a military objective but as a strategic chess piece in his broader confrontation with China. He has described the base as being “an hour away from where [China] makes its nuclear weapons,” framing it as a critical outpost the U.S. should never have given up. In Trump’s view, reclaiming Bagram would reestablish American dominance in a region he believes is drifting into Beijing’s orbit. It’s also a powerful political narrative: take back what Biden lost, restore strength and project American resolve in an era of perceived decline.

But while Trump talks about taking Bagram back, China has already moved in. After the U.S. withdrawal in 2021, Beijing wasted little time expanding its influence, becoming the first country to accredit a Taliban ambassador in 2023.

In August 2025, Chinese Foreign Minister Wang Yi visited Kabul for high-level talks, during which Beijing signaled interest in Afghanistan’s vast mineral reserves, including lithium, copper and uranium, and in expanding trade and infrastructure links under its Belt and Road Initiative. For China, Afghanistan is now a critical strategic partner. A renewed U.S. military presence would threaten those interests, and Beijing is unlikely to stand by quietly if Washington tries to force its way back in.

Some analysts believe Trump’s demand may be less about actually retaking Bagram and more about creating leverage. It could be a bargaining chip, a maximalist opening meant to extract something smaller, such as the return of some of the $7 billion in U.S. weapons left behind during the withdrawal. He might seek assurances regarding the protection of minority rights or commitments to restrict terrorist safe havens in exchange for concessions, even though concerns of ISIS-K and other terror groups have proven illusory.

According to Helena Malikyar, Afghanistan's former ambassador to Italy, “The U.S. has military bases in many other countries, but that doesn’t necessarily imply a colonizer-colonized relationship — consider Japan, Germany, Qatar, or Bahrain.” She adds: “That said, I doubt the U.S. has any urgent need for Bagram, given that Pakistan has granted access to its airbases since 1959. In fact, the airbases in Khyber Pakhtunkhwa and Punjab are even closer to China than Bagram is.”

Rhetorically, Trump’s ploy also plays well, allowing him to cast Biden’s exit from Afghanistan as a historic blunder that he alone is prepared to fix. But whether it’s a bluff or a real objective, the rhetoric raises the stakes, and regional powers like China, Russia and even the Taliban are watching closely.

But as Zalmai Nishat, Research Fellow at Sussex Asia Centre, points out, “the Taliban is far from monolithic. While certain factions may see benefit in cooperating with the U.S., others, particularly those tied closely to Hibatullah [Akhundzada], would fiercely resist. Any move to reclaim Bagram would expose these divisions, and the Taliban’s response would depend on which faction prevails.”

This internal fragmentation is only one layer of a far more complex equation. Trump’s push for Bagram would not just challenge the Taliban but also confront a regional order that no longer centers on Washington. Realities on the ground have shifted dramatically since the days of U.S. occupation. China is intent on solidifying its role in Afghanistan’s reconstruction and won’t tolerate a U.S. return that threatens its access to valuable minerals or its broader security interests.

Iran would certainly see U.S. facilities as potential targets and Russia, the first country to formally recognize the Taliban government, has a broad footprint in Afghanistan today. It provides oil and wheat at discounted prices, cooperates with its security services on counterterrorism programs and promotes its 11-nation Moscow Format to address Afghan issues. Neither Beijing nor Moscow is likely to support a renewed American military presence that could destabilize the fragile balance they seek to maintain.

Critically, the American people are likely to reject a military redeployment to a country where two decades of fighting achieved little and the threat of Afghanistan turning into a sanctuary and safe haven for terrorism has not borne out.

Even if the Taliban were to agree to a negotiated solution, it would be difficult for President Trump to sell the deal. It took two decades after the fall of Saigon for the United States to reestablish diplomatic relationships with Vietnam, and it’s reasonable to believe that popular and congressional support would be equally opposed. Like most of President Trump’s verbal and Truth Social pronouncements, the Bagram proposal can be taken literally or seriously, but not both.

keep readingShow less
Top photo credit: Leader of ANO party Andrej Babis speaks during a press conference after the preliminary results of the parliamentary election, at the party's election headquarters in Prague, Czech Republic, October 4, 2025. REUTERS/Radovan Stoklasa

Populist, EU-Ukraine skeptic wins big in Czech elections


20,506 posted on 10/08/2025 11:59:35 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 20505 | View Replies]

Israeli Prime Minister Benjamin Netanyahu said he supported the plan following a meeting with Trump at the White House on Monday, but it’s unclear if Hamas will accept these terms.

Here is Trump’s proposal, verbatim:


1. Gaza will be a deradicalized terror-free zone that does not pose a threat to its neighbors.

2. Gaza will be redeveloped for the benefit of the people of Gaza, who have suffered more than enough.

3. If both sides agree to this proposal, the war will immediately end. Israeli forces will withdraw to the agreed upon line to prepare for a hostage release. During this time, all military operations, including aerial and artillery bombardment, will be suspended, and battle lines will remain frozen until conditions are met for the complete staged withdrawal.

4. Within 72 hours of Israel publicly accepting this agreement, all hostages, alive and deceased, will be returned.

5. Once all hostages are released, Israel will release 250 life sentence prisoners plus 1700 Gazans who were detained after October 7th 2023, including all women and children detained in that context. For every Israeli hostage whose remains are released, Israel will release the remains of 15 deceased Gazans.

6. Once all hostages are returned, Hamas members who commit to peaceful co-existence and to decommission their weapons will be given amnesty. Members of Hamas who wish to leave Gaza will be provided safe passage to receiving countries.

7. Upon acceptance of this agreement, full aid will be immediately sent into the Gaza Strip. At a minimum, aid quantities will be consistent with what was included in the January 19, 2025, agreement regarding humanitarian aid, including rehabilitation of infrastructure (water, electricity, sewage), rehabilitation of hospitals and bakeries, and entry of necessary equipment to remove rubble and open roads.

8. Entry of distribution and aid in the Gaza Strip will proceed without interference from the two parties through the United Nations and its agencies, and the Red Crescent, in addition to other international institutions not associated in any manner with either party. Opening the Rafah crossing in both directions will be subject to the same mechanism implemented under the January 19, 2025 agreement.

9. Gaza will be governed under the temporary transitional governance of a technocratic, apolitical Palestinian committee, responsible for delivering the day-to-day running of public services and municipalities for the people in Gaza. This committee will be made up of qualified Palestinians and international experts, with oversight and supervision by a new international transitional body, the “Board of Peace,” which will be headed and chaired by President Donald J. Trump, with other members and heads of State to be announced, including Former Prime Minister Tony Blair. This body will set the framework and handle the funding for the redevelopment of Gaza until such time as the Palestinian Authority has completed its reform program, as outlined in various proposals, including President Trump’s peace plan in 2020 and the Saudi-French proposal, and can securely and effectively take back control of Gaza. This body will call on best international standards to create modern and efficient governance that serves the people of Gaza and is conducive to attracting investment.

10. A Trump economic development plan to rebuild and energize Gaza will be created by convening a panel of experts who have helped birth some of the thriving modern miracle cities in the Middle East. Many thoughtful investment proposals and exciting development ideas have been crafted by well-meaning international groups, and will be considered to synthesize the security and governance frameworks to attract and facilitate these investments that will create jobs, opportunity, and hope for future Gaza.

11. A special economic zone will be established with preferred tariff and access rates to be negotiated with participating countries.

12. No one will be forced to leave Gaza, and those who wish to leave will be free to do so and free to return. We will encourage people to stay and offer them the opportunity to build a better Gaza.

13. Hamas and other factions agree to not have any role in the governance of Gaza, directly, indirectly, or in any form. All military, terror, and offensive infrastructure, including tunnels and weapon production facilities, will be destroyed and not rebuilt. There will be a process of demilitarization of Gaza under the supervision of independent monitors, which will include placing weapons permanently beyond use through an agreed process of decommissioning, and supported by an internationally funded buy back and reintegration program all verified by the independent monitors. New Gaza will be fully committed to building a prosperous economy and to peaceful coexistence with their neighbors.

14. A guarantee will be provided by regional partners to ensure that Hamas, and the factions, comply with their obligations and that New Gaza poses no threat to its neighbors or its people.

15. The United States will work with Arab and international partners to develop a temporary International Stabilization Force (ISF) to immediately deploy in Gaza. The ISF will train and provide support to vetted Palestinian police forces in Gaza, and will consult with Jordan and Egypt who have extensive experience in this field. This force will be the long-term internal security solution. The ISF will work with Israel and Egypt to help secure border areas, along with newly trained Palestinian police forces. It is critical to prevent munitions from entering Gaza and to facilitate the rapid and secure flow of goods to rebuild and revitalize Gaza. A deconfliction mechanism will be agreed upon by the parties.

16. Israel will not occupy or annex Gaza. As the ISF establishes control and stability, the Israel Defense Forces (IDF) will withdraw based on standards, milestones, and timeframes linked to demilitarization that will be agreed upon between the IDF, ISF, the guarantors, and the Unites States, with the objective of a secure Gaza that no longer poses a threat to Israel, Egypt, or its citizens. Practically, the IDF will progressively hand over the Gaza territory it occupies to the ISF according to an agreement they will make with the transitional authority until they are withdrawn completely from Gaza, save for a security perimeter presence that will remain until Gaza is properly secure from any resurgent terror threat.

17. In the event Hamas delays or rejects this proposal, the above, including the scaled-up aid operation, will proceed in the terror-free areas handed over from the IDF to the ISF.

18. An interfaith dialogue process will be established based on the values of tolerance and peaceful co-existence to try and change mindsets and narratives of Palestinians and Israelis by emphasizing the benefits that can be derived from peace.

19. While Gaza re-development advances and when the PA reform program is faithfully carried out, the conditions may finally be in place for a credible pathway to Palestinian self-determination and statehood, which we recognize as the aspiration of the Palestinian people.

20. The United States will establish a dialogue between Israel and the Palestinians to agree on a political horizon for peaceful and prosperous co-existence.


20,507 posted on 10/08/2025 12:02:01 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 19818 | View Replies]

To: ETCM; BeauBo; SpeedyInTexas
More details

OSINT Study: Russia Has Exhausted Over Half of Its Stockpiles of Armored Vehicles and Artillery

The Russian military has depleted more than half of its stockpiles of armored vehicles and artillery held in storage.

https://militarnyi.com/en/news/osint-study-russia-has-exhausted-over-half-of-its-stockpiles-of-armored-vehicles-and-artillery/

20,508 posted on 10/08/2025 12:35:52 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 20502 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 20,441-20,46020,461-20,48020,481-20,50020,501-20,508 last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson