Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 19,821-19,84019,841-19,86019,861-19,880 ... 20,161-20,165 next last
To: SpeedyInTexas
The Russian Central Bank likely prematurely lowered its key interest rate for the third time since June 2025 in an attempt to maintain the facade of domestic economic stability. The lowering of the key interest rate will likely continue to exacerbate Russia's economic instability. The Russian Central Bank announced on September 12 that it lowered its key interest rate from 18 to 17 percent.[24] The Central Bank previously lowered its key interest rate from a record 22-year high of 21 percent to 20 percent in June 2025 and lowered it again to 18 percent in July 2025.[25] The Central Bank claimed that officials measured annual inflation at 8.2 percent as of September 8 and forecasted that annual inflation in Russia will decline to between six and seven percent for the remainder of 2025 and four percent for 2026. The Central Bank acknowledged that the Russian economy is still highly susceptible to pro-inflationary rises associated with high inflation expectations and deteriorating Russian foreign trade. The Central Bank's decision to lower the key interest rate will likely adversely affect the Russian economy and raise inflation by weakening consumer purchasing power, devaluing the ruble in the medium-to long-term and creating deeper macroeconomic instability.[26]
https://freerepublic.com/focus/bloggers/4219673/posts?page=19808#19808

Кремлевская табакерка
The Kremlin is dissatisfied with the reduction in the key rate. The Central Bank responded with words about food cards

Our sources in the Kremlin believe that the Central Bank should have reduced the key rate not to 17%, but “much more significantly - at least to 14%.” “Reducing the key rate is a very positive signal. But we expected more from Nabiullina, reducing the rate to 14%, or better - to 11-12%. We hope that in the coming months our expectations will be met,” said the source in the Presidential Administration. A source in the Central Bank in response to this said that “the rate could not be reduced even now.”

“We were asked by very important people, and we conceded a little. It is clear that such a reduction in the rate will affect lending, but, for example, it will not return a full-fledged mortgage. And the rate cannot be reduced in the future. Otherwise, there will be such an increase in prices that it will be necessary to urgently introduce food cards for a number of categories of the population,” he said.

We wrote that the cards could be introduced in October, but the decision has not yet been made. Nabiullina’s associate believes that in this matter “much will depend on factors not directly related to the economy. From the NWO, enemy strikes, our reaction and the behavior of Russia's partners and opponents in the world.”

https://t.me/kremlin_secrets/6166

The Muscovite war economy is slowly but surely destroying the real economy.

19,841 posted on 09/14/2025 3:08:27 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 19808 | View Replies]

A Century Later, China Might Want Outer Manchuria Back

Long seen as unjustly taken by imperial Russia, the region remains rich in natural resources and strategically positioned. Its reclamation would not only fulfill a historical grievance but also serve Beijing's growing economic and geopolitical needs.

As Russia's position continues to erode under the weight of war, debt, and diplomatic isolation, China is uniquely positioned to press its advantage. The Kremlin is already reliant on Beijing to offload discounted oil and gas and to serve as a critical diplomatic partner. In exchange for continued economic and political support, China could quietly lay the groundwork for territorial concessions.

More than 160 years ago, Russia leveraged China's weakness to seize Outer Manchuria. Today, that dynamic may be reversing. As Beijing grows bolder and Moscow more dependent, the possibility of China reclaiming what it considers ancestral land can no longer be dismissed as improbable.

https://intpolicydigest.org/a-century-later-china-might-want-outer-manchuria-back/

Кремлевская табакерка

Will Russian officials be obliged to learn Chinese?

Rumors that it would not be superfluous for Russian officials to know Chinese have been circulating for a long time. This time there was information that they want to approve the need for study at the official level. “Given the geopolitical partnership between Moscow and Beijing, learning Chinese looks like a logical step. At least you need to know the basics of Chinese,” said the source in the Presidential Administration.

The interlocutor did not name either the terms or the list of those who will be obliged to study additionally.

https://t.me/kremlin_secrets/6171

19,842 posted on 09/14/2025 3:28:24 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 19841 | View Replies]

Кремлевская табакерка

Patriarch Kirill blesses drone flight to Poland and often talks with Putin about life after death

A senior source in the Church shared with us some details of the personal communication between the president and Patriarch Kirill. “Recently, the patriarch said that his father baptized Vladimir Vladimirovich. In continuation of this outstanding story, this sign of God's providence, I want to share with you some details of the communication between our primate and president,” the channel's interlocutor said.

He noted that Vladimir Putin often consults with the head of the Russian Orthodox Church on important issues, including military ones. “Vladimir Vladimirovich asked His Holiness the Patriarch whether it was worth starting a special military operation. He warmly supported him. From the recent one, it is worth remembering that the patriarch blessed the president to conduct an operation, as a result of which our drones visited Poland and showed the real “strength” of NATO,” the source said.

Also, the head of the Russian Church and the president often talk “about the future and about eternal things.” “Vladimir Vladimirovich from time to time, especially when he is in a philosophical mood, discusses what legacy he will leave after death. The Patriarch convinces the president that he will live at least another 20-30 years, the current development of science allows this. And after his death, of course, he will become a saint (we wrote: the head of the Church is sure that Putin will be canonized - ed.). And the face of Vladimir Vladimirovich will be depicted on icons next to our Patriarch, without any doubt. And our president will live in Russia as a saint,” the representative of the Russian Orthodox Church is sure.

He added that Putin “after conversations with Patriarch Kirill is always in a wonderful mood, because he is gaining strength for new achievements and victories.”

https://t.me/kremlin_secrets/6173

More and more articles and posts are addressing P's expected passing.

19,843 posted on 09/14/2025 3:37:28 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 19842 | View Replies]

Russian forces have run out of infantry in certain sectors, and even communications specialists and cooks are sometimes being sent into assaults, according to the Main Directorate of Intelligence of Ukraine’s Defense Ministry.

The agency says Russian losses are especially high on the Hulyaipole axis. Russian commanders have ordered attacks by the wounded and the sick, alongside communications troops, cooks, drivers and drone operators - effectively anyone available - according to what Ukrainian intelligence says it learned from radio intercepts.

Ukraine’s General Staff reports that from February 24, 2022, through September 12, 2025, Russia has lost more than 1 million personnel killed and wounded in Ukraine. Over the same period, Ukrainian forces say they have disabled, destroyed or burned more than 11,000 tanks, over 23,000 armored fighting vehicles and more than 32,000 artillery systems, and shot down 422 aircraft and 341 helicopters; they also say they have sunk 28 ships and boats.

https://www.uawire.org/ukraine-russia-is-running-out-of-infantry-sending-communications-troops-and-cooks-into-battle


19,844 posted on 09/14/2025 3:40:32 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 19843 | View Replies]

To: AdmSmith
“Vladimir Vladimirovich asked His Holiness the Patriarch whether it was worth starting a special military operation. He warmly supported him. From the recent one, it is worth remembering that the patriarch blessed the president to conduct an operation, as a result of which our drones visited Poland and showed the real “strength” of NATO,” the source said.

Too bad King Ahab Vlad can’t find a Micaiah kind of prophet to consult with instead of Zedekiah Kirill and Rasputin Dugin.

19,845 posted on 09/14/2025 6:35:07 PM PDT by GBA (Endeavor to persevere. Onward through the fog …)
[ Post Reply | Private Reply | To 19843 | View Replies]

To: gleeaikin; BeauBo; blitz128
Russian Offensive Campaign Assessment, September 14, 2025

A Russian drone entered Romanian airspace on the night of September 13, days after a Russian drone incursion into Polish airspace on the night of September 9 to 10. Romanian Defense Minister Ionuț Moșteanu reported on September 13 that Romanian forces scrambled two F-16 fighter jets from the 86th Air Base near Fetești after a Romanian radar detected a Russian drone in Romanian airspace at 1823 local time.[1] Moșteanu stated that Romania faces “provocations from Russia” nearly every week. Romanian Foreign Minister Oana-Silvia Țoiu stated that the F-16s tracked the drone until it left Romanian airspace without causing any damage or casualties 50 minutes after the moment of entry.[2] Toiu noted that two allied German Eurofighter jets were ready to aid Romanian forces, condemned the attack as “unacceptable and reckless,” and stated that Romania will take the necessary measures to protect Romanian sovereignty and security. Ukrainian President Volodymyr Zelensky noted that Russian drone flight paths are “always calculated” and that the drone did not accidentally enter the Romanian airspace due to a mistake or actions of lower-level commanders.[3] This is Russia's second incursion into NATO airspace over the course of four days. The Romanian Ministry of Defense (MoD) provided data to ABC News on September 14 indicating that Russian drones have penetrated Romanian airspace 11 times since the start of the full-scale invasion of Ukraine, inclusive of the September 13 incursion.”[4] The Romanian MoD noted that Russian drones have conducted about 50 drone strikes near the Ukrainian-Romanian border since February 2022, including 30 strikes in which drone debris fell on Romanian territory.

Poland authorized NATO reinforcements to deploy to Poland for Operation Eastern Sentry in response to the September 9 to 10 Russian drone incursion into Polish territory. Polish President Karol Nawrocki signed a decree on September 14 authorizing NATO to deploy another foreign contingent to Poland as reinforcements, specifically in support of the Operation Eastern Sentry.[5] NATO announced the start of Operation Eastern Sentry on September 12, and NATO officials noted that the intent of the operation is to reinforce NATO's eastern flank, including Poland, following the Russian drone incursion and violation of NATO airspace.[6] Polish and NATO allied aircraft scrambled, and Poland's ground-based air defense systems were activated to the highest possible readiness again in response to Russian drone strikes against Ukrainian border regions overnight on September 13 to 14.[7] NATO and member state officials have continued denouncing the Russian drone incursion into Poland and reiterated that the drone incursion was likely intentional, as ISW continues to assess.[8] Russian officials and pro-Kremlin sources have continued deflecting blame for the drone incursion and downplaying NATO states’ reactions to the drone incursion.[9] ISW continues to assess that Russia is likely attempting to gauge NATO's capabilities and reactions to the drone incursion in hopes of applying lessons learned to possible future conflicts against the NATO alliance.[10]

Russian and Belarusian forces continued the Zapad-2025 joint military exercises. The Russian Ministry of Defense (MoD) claimed on September 14 that Russian and Belarusian forces conducted several naval exercises as part of Zapad-2025, including training to use Bal coastal missile systems and Uran cruise missiles to strike simulated enemies and ships in the Barents Sea, and launch a Ka-27 naval helicopter from the Udaloy-class anti-submarine destroyer Severomorsk.[11] The Russian MoD claimed that the Russian Baltic Fleet practiced emergency rescue assistance to surface ships.[12] The Russian MoD claimed that Russian and Belarusian forces conducted several joint aviation exercises, including training to conduct long-range Il-76 military transport aircraft flights behind enemy lines, use Ka-52M and Mi-28NM combat helicopters to provide fire support for air assault landings, and fly MiG-31 interceptor aircraft with Kinzhal ballistic missiles to strike enemy targets.[13] The Russian MoD claimed that Russian Aerospace Forces (VKS) Su-34 fighter-bomber crews practiced conducting air strikes.[14] The Belarusian MoD claimed that Russian and Belarusian forces practiced conducting reconnaissance; counter-sabotage operations; relocating a command post; recapturing a defense infrastructure facility from a hostile formation; defending against forces crossing a river; operating drones, including quadcopter and first-person view (FPV) drones; operating the Kvadrat and Sprint satellite communications systems; and coordinating with military command.[15] Footage published on September 14 purportedly shows a Russian Iskander-M ballistic missile system deployed in Kaliningrad Oblast as part of the Zapad-2025 exercises.[16] Ukrainian open-source intelligence group CyberBoroshno geolocated the footage to the E28 Kaliningrad-Elblag highway about 35 kilometers from the Polish border.[17] Russia permanently deployed Iskander-M systems to Kaliningrad Oblast in 2018.[18]

A Russian milblogger claimed that the Zapad-2025 exercises are training exercises to prepare for war against NATO.[19] The milblogger claimed that Russia is one of the only countries with experience in modern warfare and that Russia should share its lessons learned in Ukraine with other Collective Security Treaty Organization (CSTO) allies, or “at least” to Belarus. Russia previously used the September 2021 exercises to prepare and secure logistics that were crucial for Russia's initial offensives into northern Ukraine at the start of the invasion.[20]

Ukraine continued its long-range drone strike and sabotage campaign against Russian oil, gas, railway, and military infrastructure in Russia and occupied Crimea on the night of September 13 to 14. The Ukrainian General Staff reported on September 14 that elements of the Ukrainian Unmanned Systems Forces (USF) and Special Operations Forces (SSO) struck the Kirishi Oil Refinery in Leningrad Oblast on the night of September 13 to 14.[21] The Ukrainian USF stated that the refinery is the second largest in Russia after the Omsk Oil Refinery, with an annual capacity of over 20 million tons of oil.[22] The Ukrainian USF stated that the refinery produces about 80 varieties of petroleum products and supplies the Russian Armed Forces. Geolocated footage published on September 14 shows a fire at the refinery's primary oil distillation unit.[23] A source within Ukraine's Main Military Intelligence Directorate (GUR) told Ukrainian broadcaster Suspilne on September 13 that GUR drone units conducted the September 13 strike against the Bashneft-Novoil Oil Refinery in Ufa, Republic of Bashkortostan, and that preliminary data indicates that explosions at the refinery caused significant damage to a vacuum column essential for primary oil processing.[24] GUR sources told Suspilne on September 14 that GUR units conducted an overnight drone strike against the Metafrax Chemical Plant in Gubakha, Perm Krai — a producer of chemicals that Russian defense industrial facilities use to manufacture explosives — and that preliminary data indicates that the strike damaged urea production equipment.[25] Geolocated footage published on September 13 shows a fire at the Metafrac Chemical Plant.[26] Perm Krai Head Dmitry Makhonin claimed on September 14 that a Ukrainian drone struck an industrial facility in Gubakha.[27]

Ukrainian intelligence sources told Suspilne on September 14 that GUR and Ukrainian Special Operations Forces (SSO) units planted an explosive device on a section of the Kursk City-Oryol City railway between Maloarkhangelsk and Glazunovka, Oryol Oblast.[28] Oryol Oblast Governor Andrey Klychkov claimed on September 14 that Russian National Guard (Rosgvardia) servicemen attempted to defuse the device on September 13 when it detonated, killing three servicemen.[29] The intelligence sources stated that the explosion destroyed the railway roadbed and fuel tanks.[30] Russian Railways claimed on September 14 that the explosion delayed 17 trains.[31] The intelligence sources stated that GUR and SSO units also detonated a section of the St. Petersburg-Pskov railway between Stroganovo and Mshinskaya in Leningrad Oblast overnight, derailing a train and destroying 15 fuel tanks.[32] The sources added that both railway sections are crucial logistical routes for Russian forces fighting in the Kharkiv and Sumy directions. Leningrad Oblast Governor Aleksandr Drozdenko claimed on September 14 that a train with 15 cars derailed in Luzhsky Raion, Leningrad Oblast.[33]

The Ukrainian Navy reported on September 14 that unspecified naval units struck the Russian Black Sea Fleet communications center at the 184th Scientific and Research Experimental Base in Sevastopol, occupied Crimea, on the night of September 10 to 11.[34] Geolocated satellite imagery taken on September 14 shows damage to two buildings at the communications center.[35]

The Kremlin is facing a massive budget deficit and may increase consumer taxes to compensate for the deficit rather than decreasing funding for its war machine, passing the economic costs off as a sacrifice that the Russian population must accept to support Russia's war in Ukraine. Several Russian government sources told Russian opposition outlet The Bell on September 11 that the Russian government is considering increasingthe Value-Added Tax (VAT), a federal tax imposed on most Russian goods and services domestically, from 20 to 22 percent in the near future due to large federal budget deficits.[36] The Russian government could generate an additional one trillion rubles annually (roughly $11.9 billion), or 0.5 percent of Russia's Gross Domestic Product (GDP), by increasing the VAT to 22 percent. This tax increase would functionally remove money from the Russian population as businesses pass most tax increases onto consumers by raising the costs of goods and services. The Russian Ministry of Finance reported on September 9 that the Russian federal budget deficit for January to August 2025 amounted to 4.2 trillion rubles (roughly $50 billion), well exceeding its planned 3.8 trillion-ruble (roughly $45 billion) deficit for all of 2025.[37] Russian President Vladimir Putin previously claimed that Russia's military budget is currently 6.3 percent of its GDP, or 13.5 trillion rubles (roughly $160 billion), much of which is likely contributing to the Russian federal budget deficit.[38] This 6.3 percent of GDP notably does not include Russia's investments in its defense industrial base (DIB) production. The Kremlin, on the contrary, offered Russian small drone producers a zero VAT rate in late July 2025.[39]

Increasing the VAT could reverse any progress the Russian Central Bank may have made against inflation while also failing to address any of the issues that will likely arise from prematurely lowering the key interest rate. A Kremlin source claimed to Reuters in late August 2025 that increasing the VAT is the only way for the Russian government to address the federal budget deficit.[40] The Russian government last increased the VAT in 2019 from 18 to 20 percent, which the Russian Central Bank reported caused inflation to rise by 0.55 to 0.7 percentage points.[41] The Russian Central Bank has been combatinginflation for the last year and has lowered its key interest rate from 21 percent to 18 percent gradually since June 2025, likely a reaction to the opinion that the Russian Central Bank's counter-inflationary measures were succeeding.[42] An increase in VAT will likely cause inflation to rise while simultaneously lowering cash flow in the Russian economy, weakening consumer purchasing power, and further stagnating Russian economic growth.[43] Putin has unintentionally created an economic situation from which Russia will struggle to escape by adopting policies aimed at increasing Russian society's reliance on military spending by heavily investing in Russia's DIB, all while Russian society faces labor and gasoline shortages, broader demographic issues, and declining savings.

see maps https://understandingwar.org/research/russia-ukraine/russian-offensive-campaign-assessment-september-14-2025/

19,846 posted on 09/14/2025 11:14:42 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 19834 | View Replies]

Day 1,298 of the Muscovian invasion. 910 [average is 844/day], i.e. more than 37 Russians and Norks/h. Vehicles and fuel tanks more than 75% and artillery more than 35% above average.


19,847 posted on 09/15/2025 12:04:17 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 19835 | View Replies]


19,848 posted on 09/15/2025 12:06:47 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 19660 | View Replies]

To: gleeaikin; BeauBo; PIF; blitz128; FtrPilot; Widget Jr; marcusmaximus; SpeedyInTexas; ETCM; ...
Кремлевская табакерка

The Church told when the explosions and fires at the most important Russian refineries will stop

A number of the most important refineries will be protected from enemy strikes in a few weeks. This is due to the fact that crosses and icons that were at the recent large-scale procession of the cross in Moscow were taken to them (we wrote about such plans, now they have been implemented). “We have sent sacred objects to a number of refineries. I will not say which ones, so as not to disclose information to the enemy. We also hold special prayer services. All this should work in a few weeks, it takes time. The situation with the refinery, as we were told in the Kremlin, is very difficult, so we cannot do without the protection of the Church,” said a high-ranking source in the Russian Orthodox Church.

He is confident that icons, crosses and prayers will protect refineries from strikes, divert drones and missiles from them, and “the situation will improve.” “Let me give you an example. We fervently prayed that the current elections in different regions of Russia would end with the right result. And so it happened. I think that in the situation with the attacks of Kiev Satanists on the refinery, prayers and sacred objects will help,” the representative of the Church added.

https://t.me/kremlin_secrets/6176

A return to the pre-scientific society with magic that prevailed in the cities more than 100 years ago and still exists in the countryside.

19,849 posted on 09/15/2025 2:49:10 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 19843 | View Replies]

To: AdmSmith
(!)
19,850 posted on 09/15/2025 3:18:47 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 19849 | View Replies]

To: blitz128
🍈


15,001 posted on 04/19/2025 6:00:31 AM PDT by JonPreston ( ✌ ☮️ )

19,851 posted on 09/15/2025 3:19:31 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 19850 | View Replies]

To: AdmSmith
there are a lot of interesting updates from the Russian Federation. Here, flying deep behind enemy lines, Ukrainian long-range drones delivered a devastating blow to the only Russian Shahed production facility. Long-range drones loaded with 250 kilogram bombs tore through the final assembly line, throwing all Russian strike plans into disarray. The Ukrainian strike happened at Yelabuga, located over 1,200 km away from the frontline. The Ukrainians used 6 drones for the strike on the main Shahed assembly facility, of which 5 Ukrainian drones managed to reach and directly strike their target despite Russian air defenses being present. The strike led to severe damage to the final assembly line of the drone production facility, creating a bottleneck and disrupting the entire production process within the factory. This assembly is the most technologically complex segment, without which the rest of the drone production process cannot be completed. Targeting this facility hampers Russia’s ability to produce new Shaheds, thereby severely impacting its ability to continue its daily drone strikes on Ukraine. For the strike, Ukrainians used small A-22 light training planes repurposed as drones to strike critical Russian military and economic infrastructure far beyond the frontline. These drones have a maximum flight range of over 1,500 km, with integrated GPS inertial guidance to conduct precision strikes. Each of these drones has an integrated payload of 250 kg, able to collapse the facility’s roof, already damaging production machinery, which was then followed by the next drone striking the factory floor itself, finishing the job. The destruction of the assembly line at the Alabuga facility throws a massive wrench into Russian plans, as the Russians are exerting considerable effort to scale up production and increase the number of Shahed drone strikes. Since the launch of this factory, which produced 300 Shahed drones daily before the Ukrainians hit it, Russia has steadily increased the number of Shahed strikes each month. Following the completion of the Alabuga drone production complex, the Russians continued to increase their production output, launching a massively increased number of Shahed drone strikes in the past 6 months. This number could have risen to 9,000 by the end of April, prompting the Ukrainians to urgently develop a plan to strike the Russian Shahed production facility. The strike on the Alabuga plant was additionally prompted by the recent Russian development of an analogue to Ukraine’s Palianytsia jet-propelled drone. The upgraded Shahed, called the Geranium-3, features a turbojet engine for increased speed, raising from 200 kph to 600. This enhancement makes it much harder for Ukrainian mobile air defense units to intercept them, primarily relying on truck-mounted machine guns and autocannons to take down the Shaheds. Western sources report that the Alabuga factory was a key producer of these new Russian jet-powered Shahed drones. With the new drones being significantly more difficult to intercept for conventional Ukrainian mobile air defense units, Ukraine would have had to rely on more expensive and very limited missile defense systems to protect its cities. Destroying Russian production capabilities before these drones could be produced and implemented on a larger scale was a strategic play to prevent the Russians from exploiting weak spots in Ukrainian air defense, while the laser air defense is still in the early stages. This also shows that Ukrainians know the locations of these critical Russian factories, and can continue to target them, if they struggle to intercept the new Shaheds. While Ukrainians have many potential targets to hit, they must choose wisely, due to the amount of time needed to plan and set conditions for such complex aerial operations, making it impossible to strike every location simultaneously. Overall, the Ukrainians conducted a precision strike on the largest and most important Russian drone production facility, over a 1,000 km away from the frontline, causing massive damage to its production capabilities and greatly diminishing the number of drones available for further Russian strikes. The effects of the Ukrainian strike will be evident, with the planned Russian increase of Shahed strikes not becoming a reality. Lastly, the strike demonstrates Ukraine’s constant awareness of potential Russian threats, making educated decisions on which facilities to hit with the most urgency, to achieve the most significant effect. https://www.youtube.com/watch?v=-Tr9_gR1_6w Reporting From Ukraine: https://www.youtube.com/@RFU/videos The complete transcript. — [ Russians Lost Air Superiority. Biggest Swedish Military Aid Package Changes The Game! ] Today [ Apr 28, 8 pm ], there is an interesting update concerning the defense of Ukrainian skies. Here, the Ukrainian air defense got one of the biggest boosts as reports emerged that a new powerful flying radar from Sweden had probably already arrived in Ukraine. This system will help the Ukrainian air defenses not only in their offensive operations but will also significantly support their ability to defend the Ukrainian rear from constant Russian missile and drone attacks. Sweden has pledged to deliver two ASC-890 airborne warning and control system planes to Ukraine as part of its largest military aid package to date, valued at approximately 1.16 billion euros. Sweden’s decision marks a significant enhancement in Ukraine’s air defense capabilities. These aircraft, equipped with advanced Erieye radar systems, are designed to provide long-range surveillance and target identification. While official confirmation is pending, there are reports that a calibration aircraft was flying over western Ukraine, which might indicate Ukrainians are making final preparations, recalibrating and fine-tuning ground-based radars for the arrival of the new Swedish planes. The ASC-890, based on the Saab 340 airframe, is an airborne early warning and control aircraft. It features the Erieye radar, a fixed, active electronically scanned array mounted atop the fuselage. This radar system offers a detection range of up to 450 km and can track multiple targets simultaneously, including aircraft, missiles, and drones. By operating at high altitudes of 6,000 meters, the ASC-890 can monitor vast areas, providing real-time data to command centers and enhancing situational awareness. Essentially, aircraft like the ASC-890 serve as flying radar stations and command centers, coordinating air and ground operations effectively, with its compact size and reliability making it ideal for rapid deployment. In the context of Ukraine’s current defense infrastructure, the ASC-890 represents a substantial upgrade. Ukraine’s existing radar systems are primarily ground-based, and even though some of them have a range of around 350 to 400 km, their immobility limits their range and makes them vulnerable to terrain obstructions. The ASC 890’s airborne platform overcomes these limitations, offering a broader and more flexible surveillance capability. This enhancement is crucial for the early detection of incoming threats, more accurate tracking of them, and a better response time that would allow Ukrainian air defense to intercept air threats more successfully. The integration of the ASC-890 is particularly significant in light of Ukraine’s acquisition of Western fighter jets, notably the F-16s. After the manufacturer, SAAB, made some updates to improve the interoperability between the 2 systems, the ASC-890 can now provide these aircraft with comprehensive situational awareness, guiding them to targets and alerting them to potential threats. As a result, these awacs will significantly improve the engagement range of the F-16s, allowing them to use their modern air-to-air missiles at their maximum ranges, as well as providing a significant improvement to the limited radar detection range of the F-16. This synergy enhances the operational effectiveness of fighter jets, enabling more precise and coordinated missions. Additionally, the ASC-890’s data can even support Soviet-era Ukrainian fighter jets, extending their operational capabilities despite technological disparities. Sharing real-time radar data and threat information with ground-based command centers, Ukrainians can then relay targeting and situational awareness updates to the pilots via secure radio or datalink. This allows older aircraft, despite lacking modern onboard radars, to operate more effectively by flying with external guidance and warning support. Contrastingly, Russia’s equivalent platform, the Beriev A-50, has faced significant challenges. Since early 2024, Ukraine has successfully targeted and destroyed at least two A-50 aircraft, utilizing systems like the Patriot missile defense. These losses have compelled Russia to operate its remaining A-50 fleet even further from the front lines, diminishing its surveillance effectiveness over Ukrainian territory. [ Now grounded ] The reduced presence of A-50s near Ukraine hampers Russia’s ability to conduct continuous airborne surveillance and coordinate air operations effectively. Overall, the arrival of Sweden’s ASC-890 aircraft is a strategic boon for Ukraine, especially amid uncertainties regarding continued American intelligence support. These aircraft not only bolster Ukraine’s air defense and surveillance capabilities but also ensure greater autonomy in operational planning and threat response. As the war continues the ASC890 will fill in gaps as a critical asset in safeguarding Ukrainian airspace and enhancing the effectiveness of its aerial operations.
19,852 posted on 09/15/2025 3:23:24 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 19552 | View Replies]

To: SpeedyInTexas
KYIV — U.S. President Donald Trump finally labeled Russia the aggressor in the war against Ukraine, further demonstrating a hardening of his position toward Moscow.

Referring to Ukrainian and Russian troop casualties, Trump told reporters Sunday: “8,000 soldiers have died this week, from both countries. Some more from Russia, but when you're the aggressor, you lose more. Trump has previously refused to condemn Moscow for the invasion, with his administration siding with Russia and North Korea in February to reject a U.N. motion backing Ukraine's territorial integrity and condemning Russia. The U.S also objected to a G7 statement calling Russia an aggressor in February. Trump has blamed Ukraine for the war, saying in April: “You don't start a war against someone 20 times your size and then hope that people give you some missiles.”

But Trump's stance toward the Kremlin has changed over the summer, with his administration exerting increasing pressure on Vladimir Putin as the Russian president stonewalls Trump's efforts to broker direct peace talks with Ukraine's Volodymyr Zelenskyy.

On Friday, U.S. Secretary of Energy Chris Wright told POLITICO that the U.S. wants “to displace all Russian gas,” saying: “The more we can strangle Russia's ability to fund this murderous war, the better for all of us.”

https://www.politico.eu/article/donald-trump-calls-russia-an-aggressor-in-war-against-ukraine/

19,853 posted on 09/15/2025 4:33:46 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 19843 | View Replies]

To: JonPreston

June 25th 😂


19,854 posted on 09/15/2025 5:34:53 AM PDT by blitz128
[ Post Reply | Private Reply | To 19850 | View Replies]

To: blitz128; AdmSmith

admsmith just posted some new BlueSky and Politico material, and you have the nerve to question me? What’s wrong with you Neocons?


19,855 posted on 09/15/2025 5:38:15 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 19854 | View Replies]

To: blitz128; gleeaikin; AdmSmith
I am not on blue sky Better to let the loonies expose themselves IMO

The two loony recipients above post BlueSky material here daily and you engage them, so there really is no need to expose them.

19,856 posted on 09/15/2025 5:44:52 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 19838 | View Replies]

To: blitz128

I forgot to mention the OCD indication earlier today.


19,857 posted on 09/15/2025 6:19:19 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 19854 | View Replies]

To: AdmSmith

“President Donald Trump finally labeled Russia the aggressor in the war against Ukraine”

Sanctions in 2 weeks!!!


19,858 posted on 09/15/2025 7:34:47 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 19853 | View Replies]

To: PIF

Lets just Nuke RuZZia and get it over with.


19,859 posted on 09/15/2025 7:35:19 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 19858 | View Replies]

To: SpeedyInTexas

“Some more from Russia, but when you’re the aggressor, you lose more.”

It was a sort of an oblique reference and not really an outright condemnation. That seems to indicate that 47 still blames Ukraine, but is now miffed at his BFF being so stubborn.


19,860 posted on 09/15/2025 8:30:44 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 19858 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 19,821-19,84019,841-19,86019,861-19,880 ... 20,161-20,165 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson