Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 19,461-19,48019,481-19,50019,501-19,520 ... 20,981-20,986 next last
To: ETCM; blitz128

Another report from today on the ERAM sale.

When they say “the missiles could be delivered to Ukraine later this year.”, I don’t know if they mean all of them, or just the first of them. Range like a Storm Shadow/SCALP Cruise Missile, but a 500 lb warhead on the ERAM, vs. 1,000 on the Storm Shadow. Great for refineries, but not as much of a bunker buster.

Kyiv Independent (29 Aug):

“The United States Department of State approved a military sale to Ukraine for Extended Range Attack Munition (ERAM) missiles and related equipment worth an estimated $825 million, the agency announced on Aug. 28.

“Up to 3,350 ERAM missiles and 3,350 navigation modules to counter spoofing will be procured,” Presidential Office Chief of Staff Andriy Yermak wrote on social media, confirming the deal...

According to an official State Department press release... the “sale will improve Ukraine’s capability to meet current and future threats by further equipping it to conduct self-defense and regional security missions.”

The press release noted that “Ukraine will use funding from Denmark, the Netherlands, and Norway... for this purchase.” This was also confirmed by Yermak on social media.

An undisclosed source told CNN that if the sale is concluded as expected, the missiles could be delivered to Ukraine later this year. It remains unclear whether the U.S. plans to impose range restrictions on the arms.

Earlier in July, the United States and North Atlantic Treaty Organization (NATO) reached an agreement for alliance members to purchase American weapons for Ukraine through the Prioritized Ukraine Requirements List (PURL) initiative.

Since the beginning of August, NATO allies such as Canada, Denmark, Germany, the Netherlands, Norway, and Sweden have committed to funding PURL packages for Ukraine. International military support remains critical for Kyiv, as Russia continues to attack Ukrainian civilian targets on a regular basis.”


19,481 posted on 08/29/2025 10:33:51 AM PDT by BeauBo
[ Post Reply | Private Reply | To 19472 | View Replies]

To: JonPreston
How about posting the link.

Even if it is in Russian.

19,482 posted on 08/29/2025 3:32:44 PM PDT by Widget Jr (⚖⛓️☭ Russia is the career criminal of countries. ☭⛓️⚖)
[ Post Reply | Private Reply | To 19479 | View Replies]

To: FtrPilot

“Kuibyshev oil refinery in Samara has fully halted operations after a night drone attack on August 28”

Samara Oblast refineries taking it hard...

Kyiv Independent (29 Aug):

“The refinery, operated by Rosneft, saw both of its main crude distillation units — CDU-4 and CDU-5, each with a capacity of 70,000 barrels per day — taken offline in the strikes. Some secondary units were also affected, the sources said.

The halt comes just a week after the facility resumed operations on Aug. 21 following a major overhaul that had been underway since July 1. Rosneft has not commented on the incident, according to Reuters.

The Kuibyshevsk refinery, located in Russia’s Samara region, is part of Rosneft’s Samara group of refineries, which also includes the Novokuibyshevsk and Syzran plants. Both have also been targeted by Ukrainian drones this month. The Syzran refinery has remained offline since Aug. 15 due to damage, while the Novokuibyshevsk site was struck on Aug. 2.”


19,483 posted on 08/29/2025 3:33:20 PM PDT by BeauBo
[ Post Reply | Private Reply | To 19475 | View Replies]

To: BeauBo; All

Oil refinery exploding and burning in Krasnodar after Ukrainian drone strikes tonight.


19,484 posted on 08/29/2025 6:04:14 PM PDT by marcusmaximus
[ Post Reply | Private Reply | To 19483 | View Replies]

To: BeauBo

Another refinery burning in Syrzan tonight.


19,485 posted on 08/29/2025 6:10:35 PM PDT by marcusmaximus
[ Post Reply | Private Reply | To 19483 | View Replies]

To: marcusmaximus

2 a day, keep it up


19,486 posted on 08/29/2025 6:14:26 PM PDT by blitz128
[ Post Reply | Private Reply | To 19485 | View Replies]

To: blitz128

Krasnodar is burning nicely.


19,487 posted on 08/29/2025 6:29:33 PM PDT by marcusmaximus
[ Post Reply | Private Reply | To 19486 | View Replies]

To: marcusmaximus

“Oil refinery exploding and burning”

“Another refinery burning”...

I see a pattern...

Send more Drones, Missiles and Artillery!


19,488 posted on 08/29/2025 8:26:42 PM PDT by BeauBo
[ Post Reply | Private Reply | To 19485 | View Replies]

Day 1,282 of the Muscovian invasion. 850 [average is 842/day], i.e. more than 35 Russians and Norks/h. Vehicles and fuel tanks more than 130% and artillery more than 140% and artillery more than 55%above average.


19,489 posted on 08/29/2025 11:53:15 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 19434 | View Replies]

To: gleeaikin; BeauBo; PIF; blitz128; FtrPilot; Widget Jr; marcusmaximus; SpeedyInTexas; ETCM
Russian Offensive Campaign Assessment, August 29, 2025

Russia reportedly leveraged the August 15 Alaska Summit in order to stall for a planned Fall 2025 offensive, among other things. A German source with insider knowledge told Reuters that Ukrainian officials warned German officials on August 13 that Ukrainian intelligence assessed that Russian President Vladimir Putin planned to use the Alaska Summit to “play for time” ahead of a potential Russian offensive in October or November 2025.[1] This report is consistent with recent Ukrainian warnings of Russian efforts to prepare for renewed offensives in the future, though it is not yet clear where Russian forces may focus their main effort in Fall 2025. Ukrainian President Volodymyr Zelensky stated on August 12 that Russia may transfer 15,000 troops to the Zaporizhia direction, 7,000 troops to the Pokrovsk direction, and 5,000 troops to the Novopavlivka direction to intensify offensive operations in these areas in the near future.[2] Ukrainian Main Military Intelligence Directorate (GUR) Deputy Chief Major General Vadym Skibitskyi stated in an interview published on August 12 that Russian forces planned to achieve all their objectives near Kupyansk, Chasiv Yar, Toretsk, and Pokrovsk — presumably seizing the entirety of these towns — by the end of August or start of September 2025.[3] Skibitskyi stated that Russian forces postponed their initial plan to seize the remainder of Donetsk Oblast by August 1 to December 31, 2025, and that Russian forces increased strikes against Kherson City in accordance with plans to do so. Russian forces notably took advantage of the August 15 Alaska Summit to intensify ongoing offensive operations in certain areas of the theater, such as conducting an infiltration operation near Dobropillya, and to stockpile drones and missiles that Russian forces used to strike Kyiv and inflict heavy civilian casualties overnight on August 27 to 28.[4] Reports that Russian forces are still planning for a Fall 2025 offensive support ISW’s long-term assessment and Russian Foreign Minister Sergey Lavrov’s recent statements that the Kremlin's war aims in Ukraine have not changed.[5]

Russian Defense Minister Andrei Belousov gave a major speech at the Russian Ministry of Defense (MoD) Collegium on August 29. Belousov gave an update on the ten priority directions for the Russian MoD. Belousov also discussed Russian battlefield progress in Ukraine and exaggerated Russian gains in recent weeks. Belousov claimed on August 29 that Russian forces seized roughly 300 to 400 square kilometers of Ukrainian territory per month at the beginning of 2025 but that Russian forces are currently seizing roughly 600 to 700 square kilometers per month.[6] ISW assesses that Russian forces seized roughly 426.85 square kilometers of territory in January 2025, 310.67 square kilometers in February 2025, 193.19 square kilometers in March 2024, 173.79 square kilometers in April 2025, 499.28 kilometers in May 2025, 465.80 square kilometers in June 2025, 445.88 square kilometers in July 2025, and about 500 square kilometers thus far in August 2025. Russian advances in August 2025 are far below Belousov’s claims. Belousov’s statement also ignores that Russian forces are making these gains in open fields and areas with minimal fortifications, through failed infiltration operations such as those east and northeast of Dobropillya, and at heavy personnel losses.[7] Ukrainian General Staff reporting about Russian personnel casualties thus indicates that Russian forces suffered an average of 938 personnel casualties per day thus far in August 2025.[8] Belousov stated that 97 percent of wounded in action (WIA) servicemembers return to the frontlines “after being wounded,” which is consistent with reports that the Russian military command continues to send injured Russian personnel on attritional, infantry-led assaults.[9]

Belousov indicated that the Russian MoD has shifted its priorities to produce light vehicles over heavy armored vehicles, reflecting Russian battlefield tactics since winter 2024–2025. Belousov claimed that the Russian MoD procured and delivered 22,725 motorcycles, all-terrain vehicles (ATVs), and buggies to the frontlines and plans to deliver an additional 12,186 light vehicles to Russian forces along the frontlines by the end of August 2025.[10] ISW previously observed reports from unspecified Russian military sources that claimed that Russia purchased over 40,000 Chinese-made motorcycles in 2024 and intends to purchase up to 200,000 motorcycles and 60,000 other light vehicles in 2025.[11] Russian forces are increasingly fielding light vehicles including motorcycles, all-terrain vehicles (ATVs), and buggies in lieu of heavy armored vehicles such as tanks due to their maneuverability and cheap cost relative to armored vehicles, which Ukrainian drone operations threaten.[12] Russian forces have not implemented adequate protection for armored vehicles and tanks against Ukrainian drone strikes and Russia faces declining tank and armored vehicle stockpiles.[13]

Belousov stated that Russia continues to focus on developing its Unmanned Systems Forces and drone production capacity. Belousov stated that Russian forces are focused on integrating elements of the Russian Unmanned Systems Forces units into the wider Russian forces and noted that the MoD must still augment logistics and repairs, implement faster training of drone operators, and better staff unmanned systems units.[14] The Russian MoD launched a coordinated effort in August 2024 to create a centralized separate service for unmanned systems, likely to centralize the MoD’s control over informal specialized drone detachments and unmanned systems procurement.

Belousov indicated that the Russian MoD is expanding its efforts to digitalize Russian recruitment likely as part of wider efforts to augment Russia's administrative capacity to handle conscription and mobilization processes. Belousov noted that the MoD continues implementing a myriad of digital changes to streamline administrative processes for Russian personnel, including onboarding new servicemembers, receiving feedback and appeals from Russian servicemembers, and digitizing the application process and issuance of combat veteran status.[15] Belousov highlighted that the MoD completed the State System of Unified Military Registration, which is a “unified digital environment” for the MoD.[16] Russia has focused on digitizing elements of the conscription and mobilization process since the partial involuntary reserve call-up in September 2022 and has digitalized aspects of this process including issuing digital draft summons for Russian conscripts.[17] Russian State Duma Defense Committee Chairperson Andrei Kartapolov introduced a bill in late July 2025 that would facilitate Russia's ability to process mobilized personnel throughout the year rather than only during the semi-annual reserve call-ups, allowing Russia to mitigate bureaucratic bottlenecks that complicate Russia's ability to conduct large-scale involuntary call-ups of conscripts and reservists.[18]

US and Ukrainian representatives met in New York City on August 29 and reaffirmed Ukraine's readiness for peace negotiations with Russia, including at the level of heads of state. Ukrainian Presidential Office Head Andriy Yermak stated on August 29 that he and Ukrainian Deputy Foreign Minister Serhiy Kyslytsia met with US Special Envoy for the Middle East Steve Witkoff and emphasized Ukraine's readiness to end the war.[26] Yermak noted that Ukraine welcomes all US-proposed peace initiatives and efforts to end the war and that Ukraine is ready for direct negotiations at the level of heads of state.[27]

The US State Department approved three Foreign Military Sales (FMS) of aviation ammunition, Starlink services, and Patriot air defense system support to Ukraine. The US Defense Security Cooperation Agency (DSCA) announced on August 28 that the US State Department approved an FMS to Ukraine worth roughly $825 million that includes up to 3,350 Extended Range Attack Munition (ERAM) air-launched missiles and 3,350 navigation systems equipped with modules equipped with anti-spoofing modules, weapons components and spare parts, support equipment, weapons software and support equipment, technical documentation, personnel training and training equipment, and logistics and transportation support.[28] The DCSA reported that Denmark, Norway, the Netherlands, and US Foreign Military Funding are funding this FMS to Ukraine. The DSCA announcement confirmed an August 24 report from the Wall Street Journal (WSJ) that the United States had approved the sale of the 3,350 ERAMs for Ukraine.[29] The DCSA announced on August 29 that the US State Department approved another FMS to Ukraine worth roughly $150 million that includes an extension of Starlink terminal support services and a third FMS to Ukraine worth roughly $179 million that includes Patriot air defense system spare parts, maintenance, and related equipment and technical support.[30]

Russian forces recently executed seven Ukrainian prisoners of war (POWs) near Myrolyubivka, Donetsk Oblast. The Ukrainian Donetsk Oblast Prosecutor's Office reported on August 29 that it opened an investigation into Russian forces who brutally tortured and executed seven Ukrainian POWs in a basement near Myrolyubivka, Donetsk Oblast in August 2025, and attempted to kill an eighth Ukrainian POW who survived the execution attempt.[31] Ukrainian outlet Suspilne detailed how the surviving Ukrainian POW crawled to safety for five days after the executions and noted that the POW had to write his account of the executions by hand because the injury Russian forces inflicted prevented him from verbally speaking.[32] There has been a sharp increase in credible reports and footage of Russian forces executing Ukrainian POWs throughout 2024 and 2025, and ISW continues to assess that Russian military commanders including battlefield commanders are either complicit in or directly enabling their subordinates to conduct systemic executions in direct violation of international law.[33]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-august-29-2025

19,490 posted on 08/30/2025 12:04:58 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 19477 | View Replies]

Кремлевская табакерка
Will the border with Azerbaijan be closed?

Ilham Aliyev’s latest statements have angered many influential people in Moscow. The idea of holding a special military operation in this country is being discussed more and more often, although so far rather in a low voice. “Aliyev is running into trouble. He is hiding behind Erdogan and trying to destabilize the Caucasus. This is unacceptable,” a source in the Kremlin said.

The government made it clear that checkpoints on the border with Azerbaijan could be “closed for repairs” as early as September. Probably not all. But some part. As a political signal to Aliyev. “Baku is sharply moving closer to Kiev. And this is in vain. You cannot test the patience of the Russian bear,” said a source in the Presidential Administration.

https://t.me/kremlin_secrets/6105

19,491 posted on 08/30/2025 12:19:11 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 19433 | View Replies]

Кремлевская табакерка
Belousov thanked Patriarch Kirill for the successful strike on Kyiv. The missiles that hit the enemy were consecrated by priests

According to our source in the Ministry of Defense, Andrei Belousov, after the strike on Kyiv, inflicted on the night of August 28, contacted the head of the Russian Orthodox Church. “Recently, priests consecrated a large batch of our missiles and Geraniums. And you see what a successful blow we've struck with God's help. Andrei Removich thanked the head of our Church for his support. His Holiness the Patriarch promised to consecrate the rockets again. And he wished the military success in their military work,” the channel's interlocutor said.

Kirill was also praised in the Kremlin. And they expressed the hope that, since the consecration of rockets worked, it is possible to hold religious processions near a number of refineries and other important facilities.

We wrote in detail about plans to protect our enterprises that suffer from enemy strikes [below].

https://t.me/kremlin_secrets/6106

Кремлевская табакерка
Russian refineries want protection from enemy strikes with the help of religious processions

According to our source in the Kremlin, Patriarch Kirill was instructed to organize and conduct religious processions near a number of refineries that have already been or may be subjected to enemy strikes.

In particular, they want to hold religious processions in the Krasnodar Territory, Rostov, Saratov, Volgograd and Samara regions. An order was also received to hold religious processions in Moscow and St. Petersburg to protect these cities from enemy drones and missiles.

Patriarch Kirill accepted the task of holding religious processions. But he fears for those who will go and go to defend the refinery. According to our sources in the Church, the Primate believes that it is now dangerous to be near oil refineries and fuel depots. And it does not rule out losses among clergy and laity.

https://t.me/kremlin_secrets/6096

19,492 posted on 08/30/2025 12:25:15 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 19491 | View Replies]

Кремлевская табакерка
Putin was offered to introduce food cards for certain categories of Russians. In the fall, prices will rise seriously, but “not as scary as expected”

In July, our source in the government gave a forecast: gasoline will rise in price in Russia, and after it - food. Gasoline is becoming more expensive, and the price increase, unfortunately, exceeded the figures that were in the forecasts. Food is also becoming more expensive. At the same time, a new rise in prices is expected in the fall. “If the situation remains as it is now, that is, we continue to destroy refineries, and fuel is in short supply, products will rise in price again. We expected that the rise in price would be 25-30% by the end of autumn. Of course, prices for some commodity items will rise in this way. But in general, I think it will be possible to curb the rise in food prices, it will be about 20%. This is serious, but not as scary as expected,” a government source told us.

There is, according to him, a more optimistic, but unlikely forecast. “They will stop shooting at us, the situation with fuel will improve, and prices will not rise so much. But I don't really believe in it,” the channel's interlocutor admitted. He also said: Vladimir Putin was given a proposal to introduce food cards for especially vulnerable categories of Russians, “so that there are no incidents caused by a shortage of basic goods and, perhaps, even in some cases hunger.”

Whether this proposal will be accepted, the source does not know. Although we should note that such an idea has already been discussed by the authorities, there have even been attempts to implement it in some regions.

https://t.me/kremlin_secrets/6107

19,493 posted on 08/30/2025 12:28:42 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 19492 | View Replies]

To: Widget Jr

Hush Neocon


19,494 posted on 08/30/2025 12:32:34 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 19482 | View Replies]

Кремлевская табакерка

Sobyanin announced the danger: there are people in Moscow who plan to aim enemy missiles at the city

Sergei Sobyanin continues to fear serious shelling of Moscow, in particular, missile strikes on the capital. And he sees a new threat in the next two months. “Sergey Semenovich received information that there are traitors in Moscow who contacted the enemy and offered him to hit the city with missiles. And they even identified several places where missiles can fly, there are points in the very center. We asked the FSB to look into the situation,” a source in the Moscow mayor's entourage told us.

According to him, traitors are “quite respectable and influential people, one might say, part of the Russian elite.” “They think that if there is a devastating shelling of Moscow, Vladimir Vladimirovich will agree to end the [war]. It is clear that this will not happen. But traitors do not understand this and actually provoke the enemy,” the channel's interlocutor explained.

The FSB refused to comment on this information. And the Ministry of Defense noted that they are constantly strengthening Moscow's air defense, “but there is nothing new and sensational in this.” “There is a war going on, shelling is possible at any time and in any way. It's time to get used to such realities. Although for Moscow, of course, we have special protection,” a source in the ministry said.

https://t.me/kremlin_secrets/6109

19,495 posted on 08/30/2025 12:33:09 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 19493 | View Replies]

Day 1,283 of the Muscovian invasion. 850 [average is 842/day], i.e. more than 35 Russians and Norks/h. Vehicles and fuel tanks more than 125% and artillery more than 140% and artillery more than 85% above average.


19,496 posted on 08/30/2025 1:10:36 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 19489 | View Replies]

Finnish police wiretap reveals Russian ‘shadow fleet’ captain instructed to destroy evidence

The captain of a Russia-linked oil tanker that damaged five subsea cables in the Baltic Sea on Christmas Day was instructed by his shipping company to destroy evidence after the ship was seized by Finnish authorities, according to legal releases. The instruction to conceal evidence is among a range of investigative material publicized by the Finnish Central Criminal Police (KRP) as part of the prosecution in the Helsinki Criminal Court. The captain of the Eagle S and two senior officers were charged earlier this month with aggravated criminal mischief and aggravated interference with communications. All three men have denied the charges.

As reported by Finnish newspaper Iltalehti, the transcript of a wiretap released as part of the prosecution of these men reveals that just days after the ship was detained, the captain — a Georgian national named Davit Vadatchkoria — was warned by the shipping company's technical department to hide a list of subsea infrastructure that the ship had crossed over. “So don't share this list with anyone, please. Destroy it. Because they will come back and demand compensation from you for all the damages,” the captain is told. He verbally agrees to destroy the list, according to Iltalehti.

Other material made public by Finnish police includes the revelation that the black box of the Eagle S was not functioning at the moment the ship severed the Estlink 2 power cable, according to national broadcaster Yle. After police ruled out intentional manipulation, the malfunction was attributed to the older vessel's systems being dependent on receiving a GPS signal, something the ship could not find due to Russian GPS interference in the region.

Prosecutors argue that the senior crew members were recklessly negligent while the defendants contend that the incident was an unfortunate but typical maritime accident. They are also challenging Finland's jurisdiction. Concerns about Russian sabotage came to a head after the incident, which followed several other similar cable breaks, although Western governments are now increasingly confident that the incidents were not directed by the Kremlin.

The Eagle S departed from the Russian port of Ust-Luga on Christmas Day with a cargo of unleaded petrol and diesel from Russia as part of what Western countries describe as Russia's “shadow fleet” — a collection of up to 1,000 decrepit vessels with opaque ownership structures that sail under flags of convenience to export sanctioned Russian goods. On Christmas Day, the ship dragged its anchor for almost 62 miles, resulting in the complete severing of multiple cables, including the Estlink 2 power cable and four telecommunications cables. Amid concerns about Russian sabotage, the Eagle S was subsequently boarded by armed police via helicopter. It was released in March minus the three members of its crew who remained under investigation. The ship's captain told journalists on Monday that he and his team have confidence in the Finnish legal system and believe they could win the case. The court sessions continue.

https://therecord.media/finnish-police-wiretap-eagles-sabotage

19,497 posted on 08/30/2025 4:02:45 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 19496 | View Replies]

OTD in 1996 Russia signed the Khasavyurt Accords which ended 1st Chechen War. Almost exactly 3 years later we staged false flags to justify tearing the agreement up to start the 2nd Chechen War.

We killed 100s of thousands of civilians. None of this should familiar.

https://bsky.app/profile/darthputinkgb.bsky.social/post/3lxmblre5z22t

19,498 posted on 08/30/2025 4:20:15 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 19497 | View Replies]

To: AdmSmith

Iran continues to spend on its military while its people run out of water, seems like a familiar theme🤔


19,499 posted on 08/30/2025 4:24:02 AM PDT by blitz128
[ Post Reply | Private Reply | To 19478 | View Replies]

To: JonPreston
Posting the google translation is OK.

Posting the link to the Telegram channel or TASS article is too much.

Got it.

19,500 posted on 08/30/2025 6:09:32 AM PDT by Widget Jr (⚖⛓️☭ Russia is the career criminal of countries. ☭⛓️⚖)
[ Post Reply | Private Reply | To 19494 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 19,461-19,48019,481-19,50019,501-19,520 ... 20,981-20,986 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson