Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 0putinsfolly; 0putinswar; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynow; anydaynowputinwins; anydaynowrussiawins; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; jonputinbot; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 16,701-16,72016,721-16,74016,741-16,760 ... 22,381-22,394 next last
To: marcusmaximus; FtrPilot

@DD_Geopolitics

https://x.com/dd_geopolitics/status/1930784081404698733?s=46&t=oXM3QUNDayEotvdo1W-zQA

🇷🇺 Smoke seen rising from Dyagilevo Air Base in Russia’s Ryazan region following Ukrainian drone strikes.

The base, which hosts strategic bombers, was previously targeted in past long-range attacks.


16,721 posted on 06/05/2025 9:46:58 PM PDT by BeauBo
[ Post Reply | Private Reply | To 16715 | View Replies]

To: gleeaikin
Russian Offensive Campaign Assessment, June 5, 2025

Russian forces are reportedly sustaining an average of 1,140 casualties per day and suffering disproportionately high personnel casualties for marginal, grinding territorial gains. Ukrainian Ministry of Defense (MoD) news agency ArmyInform reported on June 5 that an unnamed NATO official stated that Russian forces are sustaining an average casualty rate of 1,140 personnel per day, of whom nearly 975 are killed in action (KIA) – a much higher number of killed than the standard one-to-three KIA-to-wounded-in-action (WIA) ratio.[1] The NATO official noted that Russian forces suffered approximately 160,000 casualties from January to April 2025 and that Russian losses remain high despite a slight decrease in May 2025 “due to a slowdown in the pace of hostilities.” Ukrainian Commander-in-Chief General Oleksandr Syrskyi reported on May 13 that Russian forces suffered about 177,000 casualties since January 1, 2025 (an average daily casualty rate of 1,351).[2] This daily casualty rate is lower than the record high average daily casualty rate of 1,523 that Russian forces reportedly suffered in November 2024, but Russian forces are still expending quantities of manpower that are disproportionate to their marginal territorial gains.[3] Ukrainian Presidential Office Deputy Head Pavlo Palisa stated on June 4 that Russia seized only 0.4 percent of Ukraine's total territory in 2024 and just 0.2 percent thus far in 2025, which is largely consistent with ISW’s assessment of Russian advances in 2024 and 2025, respectively.[4] Palisa stated that Russia is suffering roughly 167 casualties per square kilometer of advance. ISW continues to assess that Russia's disproportionately large manpower and materiel losses for marginal territorial gains across the theater are unsustainable in the medium-term and unlikely to result in significant and rapid gains.[5]

The Kremlin continues efforts to falsely portray Russia as willing to engage in good-faith negotiations to end the war in Ukraine, despite Russia's repeated refusal to offer any concessions. Russian President Vladimir Putin used his first phone call to Pope Leo XIV on June 5 to falsely claim that Ukraine is escalating the war, whereas Russia is interested in achieving a resolution to the war in Ukraine through “political and diplomatic means.”[6] Kremlin Spokesperson Dmitry Peskov claimed on June 5 that Putin thanked the Pope for the Vatican's willingness to contribute to a peaceful resolution to the war in Ukraine.[7] Putin notably did not propose any Russian concessions or indicate that the Kremlin has relented any of its demands of Ukraine that amount to Ukraine's full capitulation. The Kremlin readout claimed that Putin instead told the Pope that any potential resolution must eliminate the war's “root causes,” reiterating a long-standing Kremlin rhetorical line aimed at falsely blaming Ukraine for Russia's invasion. Senior Russian officials have repeatedly defined these root causes as NATO's alleged violation of obligations not to expand eastward and Ukraine's alleged violations of the rights of Russian-speaking minorities in Ukraine.[8] Russian Security Council Deputy Chairperson Dmitry Medvedev notably claimed on June 3 that Russia seeks a ”swift victory” in Ukraine and the ”complete destruction” of Ukraine's government, indicating that the Kremlin remains uninterested in good faith peace negotiations and a near-term resolution to the war that does not acquiesce to its demands.[9] Putin's conversation with the Pope is likely part of the Kremlin's ongoing effort to protract negotiations by falsely portraying Russia as interested in meaningful peace negotiations and improve Russia's negotiating position by making additional battlefield gains.

North Korea reaffirmed its support for Russia's war effort in Ukraine during Russian Security Council Secretary Sergei Shoigu’s visit to North Korea on June 4. North Korean dictator Kim Jong-un reaffirmed North Korea's “unconditional support” for Russia's war effort in Ukraine and commitment to implementing the bilateral Treaty on Comprehensive Strategic Partnership during the visit.[20] ISW will report further on this meeting and Russian-North Korean cooperation in its upcoming Adversary Entente Task Force update.

Russian authorities cracked down on a publication that has previously speculated about several Russian command changes. Russian law enforcement sources told Russian state news agency TASS that authorities detained three employees of the state-owned Ural regional information agency Ura.ru on June 5 after searching the publication's editorial office in Yekaterinburg.[21] TASS and Russian state outlet RBC claimed that the investigation may be due to Ura.ru allegedly receiving funding from an organization designated as a foreign agent and that journalists allegedly bribed a law enforcement officer to obtain sensitive internal reports.[22] Ura.ru has notably reported on several Russian military command changes ahead of official announcements in previous years, including Leningrad Military District (LMD) and Central Military District (CMD) changes during Russia's war in Ukraine.[23]

more + maps https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-june-5-2025

16,722 posted on 06/05/2025 10:30:22 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 16674 | View Replies]

To: BeauBo; blitz128; FtrPilot



16,723 posted on 06/05/2025 11:27:30 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 16369 | View Replies]

To: BeauBo
Iran and Russia have deepened political and military cooperation in recent years, particularly since the Russian invasion of Ukraine in February 2022. Iran has supported Russia's invasion of Ukraine by providing Russia with Fateh-360 ballistic missiles and launchers and Shahed drones.[9] Iran reportedly purchased Russian Su-35 fighter jets in January 2025, though Russia has not yet delivered the Su-35s to Iran.[10] Russia has also supported and cooperated with Iran's Axis of Resistance in recent years. This cooperation has included working with Iran and Iranian-backed militias to attack US forces in the Middle East.[11] Russia also supported the Axis of Resistance against Israel during the October 7 War, including by providing targeting intelligence to the Houthis to support attacks on international shipping and US vessels in the Red Sea and Gulf of Aden.[12] Iran and Russia signed a strategic cooperation agreement in January 2025, which further illustrates their close collaboration and alignment in working to erode US global influence.[13]

https://www.understandingwar.org/backgrounder/iran-update-june-5-2025

16,724 posted on 06/05/2025 11:34:13 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 16723 | View Replies]

To: gleeaikin; PIF
Кремлевская табакерка
A report from North Korea almost provoked a diplomatic scandal

Relations between Russia and the DPRK have become much stronger since the liberation of the Kursk region. But the increased trust was almost spoiled by one journalistic article, our sources in the Foreign Ministry reported. As it turned out, the DPRK authorities did not like the report about the stay of a Russian journalist in their country.

At first glance, there is nothing seditious in the article. But the DPRK authorities did not agree with the wording about the unfortunate peasants and fake residents who were allegedly specially prepared to communicate with foreign tourists, the author of the sensational article claims.

The North Koreans asked to remove the report, since it “does not correspond to reality.” In the dialogue with the North Koreans, our diplomats showed toughness and the author's material remained hanging. At least for now.

https://t.me/kremlin_secrets/5760

“I felt sorry for people all the time.” Russian woman visited North Korea. Why did she return home with such a depressing feeling?

Valentina, a traveler from Moscow, went on a trip to North Korea with her husband as part of a tour group. The girl shared that she had already visited about 30 countries, but had never seen anything like this. According to the Russian, she reviewed many blogs and articles about the DPRK to prepare for the vacation, but in reality, what she saw exceeded all expectations.

“Some bloggers admire everything and see nothing bad, they only show the good. Others say that it's a terrible horror there. It seemed to me that life there is very, very hard, even though they tried to show us the best and only took us along the “right” streets,” the Muscovite notes.

“This is especially true for the peasants. We saw them when we went out of town and drove through the fields. They work almost entirely by hand, because there is no gasoline in the country. In the fields, people work with a plow, harness oxen and bulls. It is wild, because nature is against planting anything there. There is clay soil almost everywhere, a lot of sandy soil. How does anything grow there? It is incomprehensible,” the traveler was surprised

“Many friends asked me why I went to North Korea and not Thailand or Vietnam . I think that people who ask such questions simply do not understand the value and uniqueness of this experience. Everyone should see it, because it is a real open-air museum!” - the Russian woman describes her impressions of the trip.

https://lenta.ru/news/2025/06/03/korea/

16,725 posted on 06/05/2025 11:42:54 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 16677 | View Replies]

To: gleeaikin; PIF
Кремлевская табакерка

Lenin, “maybe they'll bury him within a year. And no one can do anything about it”

This is how our source in the Communist Party of the Russian Federation commented on the queues that have formed at the Mausoleum. “The Mausoleum will soon be closed for reconstruction. They promise that Vladimir Ilyich’s body will not be removed. But there are different rumors. That's why people want to see the great leader. They may never have such an opportunity again. They'll bury our Vladimir Ilyich within a year. And no one can do anything about it,” the channel's source complained.

He said that some of his fellow communists wanted to stage a protest in defense of Lenin. But they were warned that in the conditions of the SVO and the difficult security situation that has developed in Moscow, any protests could cause a harsh reaction. It must be said that Lenin's fate is indeed in question. In particular, as is known, the philosopher Alexandr Dugin proposed burying the leader. He even stated that the “removal of the body” of Lenin was already being prepared . And in the Mausoleum there will be places of worship for Russia's military successes, and later - the burial of the “real Emperor”. This is how Alexander Gelyevich calls Vladimir Putin.

In addition, some of our sources in the Kremlin assumed that Lenin's body would be taken out of the Mausoleum and buried next year . The reason is that the now deceased elder Elijah asked Vladimir Vladimirovich about this in his letter, which the president received after his death.

Now the Kremlin is reserved and reluctant to comment on the future of the Soviet leader's body. “There may be different options for Lenin. There is time to make a decision, because the restoration of the Mausoleum will last quite a long time,” one of Tabakerka’s interlocutors in the AP said vaguely.

https://t.me/kremlin_secrets/5763

They can sell Lenin to North Korea or to China as long as Xi is in charge.

16,726 posted on 06/05/2025 11:49:37 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 16725 | View Replies]

Informative

Sarcastosaurus: Bean-counting

Yesterday, few hours after the ‘release’ of my feature on the ‘size’ of the Russian bomber fleet, the SBU of Ukraine has, finally, released a ‘compendium’ of all the UAV-strikes from 1 June.

video

Nicest thing about this video is that most of it is crisp and sequences long enough to enable the identification of several aircraft. Me thinks, that's also crucial for gauging the outcome of the Operation Sider Web, concluded on 1 June 2025.

As usually, I'll start with the start - and both you, estimeed reader, and me, shall then hope I didn't mess up my related notes…

In a war of attrition - which is what this conflict meanwhile is - crucial is to knock out items the enemy cannot replace, or has major problems with replacing. The Russians can't replace any of these aircraft: they are not in production for 25 years (or longer). In the case of A-50s, they cannot even overhaul and repair, while in the case of Tu-95MS this costs them lots of time and lots of money. The Russian aviation industry was struggling with the lack of skilled workforce already before the invasion on Ukraine: ever since, it is experiencing constantly increasing problems with importing Western high-tech necessary for their avionics and weapons (so much so: the A-100 - the project for an upgrade of A-50s - was cancelled for the lack of the same, while the Su-57 is ‘heading nowhere’).

Read the report https://xxtomcooperxx.substack.com/p/bean-counting

16,727 posted on 06/06/2025 12:04:04 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 16726 | View Replies]

Day 1,198 of the Muscovian invasion. 1,160 [average is 829/day], i.e. more than 48 Russians and Norks/h. Vehicles and fuel tanks more than 135% and artillery more than 80% above average. Motorcycles are not counted yet.



6,090 to go. Thursday?

16,728 posted on 06/06/2025 12:40:55 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 16676 | View Replies]

To: AdmSmith; FtrPilot; PIF; Sleepy
“One of the drone attacks hit a large refinery operated by Lukoil, Russia’s second-biggest oil company, in the Nizhny Novgorod region, some 600 miles from the Ukrainian border. The strike caused a fire that spread thick black smoke over the morning sky, according to local authorities and images on social media.

Another drone hit near the town of Kirishi not far from St. Petersburg, Russia’s second largest city, and home to a large refinery. A third attack struck oil-storage tanks in Oryol, a region near the Ukrainian border, authorities said...

...Ukrainian attacks have caused damage severe enough to prompt monthslong repairs and required Russia to ban gasoline exports to preserve domestic supply...

...The disruption to Russia’s exports of valuable fuels has contributed to a recent rise in global diesel and gasoline prices, while crude prices have remained relatively stable.

The impact on Russia’s military fuel supply is difficult to estimate...

...“Oil refineries are unbelievably vulnerable,” said Mikhail Krutikhin, an independent Russian energy analyst. “Ukrainian drone attacks can be very efficient, and they will certainly be continued and expanded.”

Russia’s Defense Ministry said on Tuesday it had intercepted some 25 drones in various regions. Later Tuesday, the ministry said it had shot down several Ukrainian drones that took part in an attack in the Kursk region near Russia’s border with Ukraine. In the Oryol region oil-depot attack, the fire spread and local authorities had to evacuate 17 people from nearby buildings, local authorities said.

Russian refineries were built to provide protection against catastrophic damage. The plants were mostly designed according to Soviet construction codes that require them to be spread out across up to 60 process units, according to JPMorgan Chase strategist Natasha Kaneva. This builds in resilience against traditional air bombing.

Lukoil’s Nizhny Novgorod plant, which was struck on Tuesday, had already lowered throughput earlier this year because of unspecified incidents at a gasoline-producing unit in January. The reduction boosted domestic Russian gasoline prices, which, in turn, prompted the government to institute the ban on exports of the road fuel for six months from this month.

A full repair of such facilities would usually take no more than a couple of months. But sanctions have tightened Moscow’s access to Western parts, on which much of Russia’s energy industry has been built over the past few decades.

Russia has been able to source some Western parts via third countries but the process is complicated and slow, especially for specialized parts needed for oil-and-gas facilities. Russian and Chinese equivalents, meanwhile, are sometimes incompatible.

“With a bit of luck, [Kyiv’s drones] can damage not just pipelines, but also compressors, valves, control units, and other pieces of equipment that are tricky to replace because of sanctions,” Sergey Vakulenko, a nonresident scholar at the Carnegie Russia Eurasia Center and a former Russian energy executive, wrote in a recent analysis.

“You can’t replace a faulty clutch in a BMW with a similar part from a Russian-made Lada, the same applies in industry. And ‘making do’ with what’s available creates a host of knock-on problems,” he wrote.

In Russia, domestic-fuel supplies are a particularly sensitive issue for the government and oil companies in the run-up to presidential elections this month. Inflation is already running above 7%.

A fuel crisis last year showed how Russia—despite ranking as one of the top petroleum exporters—is vulnerable to shortages on the home front. A surge in prices led to a ban on diesel and gasoline exports in the early fall.”

“SpaceX is hoping to launch its first Starship test of 2024 as early as Thursday (March 14) in what it hopes will be a historic orbital flight of the world’s biggest rocket, and if you need to know when to watch it online, you’re in the right place.

While SpaceX has yet to receive final approval and a launch license for its next Starship launch from the Federal Aviation Administration, the company has said it is targeting no earlier than March 14 for the launch from its Starbase facility near Boca Chica Beach in South Texas. The company has set up a livestream on X (formerly Twitter) that begins Thursday at 7:30 a.m. EST (1130 GMT). Since SpaceX has said the webcast would start 30 minutes before launch, that would peg the launch for 8 a.m. EST (1200 GMT) on March 14. “ SpaceX’s Ship 29 & Booster 10 are ready for Flight 3

Wet Dress Rehearsal: Fuel loading test of >10,000,000 lbs (4,600 metric tons) took only >40 minutes for both booster and ship, or almost 2 tons/sec. Falcon 9 takes 35 minutes to load 488mt. Count down pushed to T minus 10 sec.

Possible Launch on Pie (π) Day March 14th - tomorrow! (if all licenses and permits are approved)

If all goes well, they will try opening &closing the payload bay door, relighting a Raptor engine in space, doing a propellant transfer.

Splash down in the Indian Ocean.

Putin again spoke about negotiations on Ukraine. There are two serious reasons

It was not for nothing that Vladimir Putin in an interview returned to the topic of negotiations on the Ukrainian crisis with Dmitry Kiselev. Several sources in the Kremlin told us about this.

“Vladimir Vladimirovich beautifully poked Zelensky and other representatives of the Kiev regime into their problems ( Ed: remembering in an interview about “the use of psychotropic drugs and a nose in cocaine,” https://t.me/rian_ru/235173 ). But we also have difficulties, and because of this the President is talking about negotiations,” said one of our interlocutors.

First, the military asked Putin to make a statement about the negotiations. “There is a threat of NATO troops entering Ukraine ( Ed: we wrote about what the military fears in this regard: https://t.me/kremlin_secrets/3674). We, of course, can talk about a nuclear war, but the situation in the area where the Northern Military District is held could become tragic in the event of direct NATO intervention; there is a threat that we will lose our advantage and initiative at the front.

Plus, the Americans are helping Ukraine again ( Ed: by the way, we warned about this: https://t.me/kremlin_secrets/3710 ). The possibility of our direct war with the West, which is constantly becoming more impudent, has not gone away. Therefore, we need to hurry to at least temporarily stop the SVO on our terms. And just, I’ll be honest, gain strength,” another source said.

Secondly, according to an interlocutor from Sergei Kiriyenko’s team, what is happening now is very unpleasant on the eve of the Presidential elections. “Ukraine continues its terrorist attacks, drone strikes, and saboteur attacks ( https://t.me/kremlin_secrets/3756). Let’s be honest, we cannot completely protect the population from them. Therefore, Vladimir Vladimirovich’s words sound logical and correct,” he believes.

16,729 posted on 06/06/2025 2:43:41 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 16728 | View Replies]

To: Mr. Lucky; FtrPilot; All

16,730 posted on 06/06/2025 3:08:40 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 47 | View Replies]


16,731 posted on 06/06/2025 3:19:46 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 16730 | View Replies]

WHERE DID KYRYKO BUDANOV DISAPPEAR TO?


16,732 posted on 06/06/2025 3:47:16 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 16731 | View Replies]

To: BeauBo

There are unverified reports that Russia may have lost 1 maybe 2 nuclear subs in that same attack. Any news on that is welcome.


16,733 posted on 06/06/2025 4:39:44 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 16709 | View Replies]

To: BeauBo

”Sometimes you see two young children fighting like crazy,”


47 is still framing the war as Ukraine’s fault.

I keep wondering - in light of 47’s apparent continual siding with Putin, if the whole thing about 47 and the Russian hookers [ although seemingly debunked ] could have some truth or something even worse that Putin has over 47? Or is 47 as naive as a 6 year old, or just plain ignorant of modern history with Russia?


16,734 posted on 06/06/2025 4:45:48 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 16712 | View Replies]

To: AdmSmith

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

The complete transcript.

[ Offensive Cancelled! Massive Build-up Struck with HIMARS! ]

Today [ June 5 ], there are a lot of important updates from the Sumy direction. Here, along the Sumy border, Ukrainian forces lured Russian units into counterattacks and then traced their movements back to hidden staging grounds across Kursk. With their positions exposed, HIMARS batteries struck hard, delivering devastating blows to troop concentrations, command posts, and infrastructure critical to Russia’s planned offensive.

Over 50,000 Russian troops have been deployed to the Kursk region along the northern border with Sumy, signaling clear preparations for a full-scale offensive. Ukrainian commanders in the area have confirmed the buildup, noting that these forces are being readied for large-scale operations aimed at breaching the Sumy region’s defenses. The massive Russian forces concentration here underscores their conviction that they can still achieve victory through overwhelming manpower and renewed offensives.

To neutralize this threat as much as possible, Ukrainians needed to eliminate these large forces concentrations before they had the opportunity to move to the frontline. To accomplish this, Ukrainians launched attacks on the eastern flank of Tyotkino to force a Russian redeployment and draw forces away from the town itself.

By threatening a potential outflank, they put pressure on Russian positions while conducting swift rotations to keep fresh troops and equipment on the front line. This way, Ukrainians also improve their defensive position against Russian pressure across this section of the front, while their main offensive units threatens a 2-pronged assault on Tyotkino.

Combat footage from the area shows Ukrainian armored vehicles rotating efficiently, one withdrawing to resupply, while another engages Russian positions, ensuring constant pressure on enemy lines. This tactic prevents Russian forces from massing at strongpoints and forces them into improvised defensive positions in open terrain. As Russian troops rushed forward to plug gaps and prevent a Ukrainian breakthrough, many were eliminated by FPV drone strikes.

Even attempts to move in small groups of 2 or 3 failed to evade detection, as drones continued targeting them with precision. However most importantly, Ukrainians traced these movements, revealing the locations of Russian troop concentrations and command posts, opening the door for devastating Ukrainian strikes.

This critical intelligence allowed HIMARS crews to lock in their targets and strike several Russian military bases simultaneously. Footage confirms that Ukraine hit 2 Russian deployment points in Lgov and Rylsk, as local residents report large numbers of casualties among Russian soldiers being taken away in the aftermath. Russians were also spotted gathering their forces in an abandoned hospital building, as the strike completely devastated the building and any Russian soldiers inside.

Ukrainians also targeted Russian command posts, to disrupt the Russian offensive preparations and inflict severe losses. Moreover, as reported previously, one of the victims of the recent strikes was the deputy commander of 155th Marine Brigade who was reportedly eliminated by a precision strike on his command post in Rylsk.

These strikes show that Ukrainians are already draining Russian reserves even before they can launch their offensive. They are disrupting Russian preparations and inflicting losses, further limiting what they can achieve. If Russians redeploy their forces further to the rear to try and stay undetected, these forces will not be able to respond quickly to sudden breakthroughs or Ukrainian assaults.

This gives Russians a painstakingly tough dilemma, either Russians will have to station their forces much further to the rear, or they must take the blows dealt to them by Ukrainian strike teams, betting on their numbers being enough to still make a breakthrough, despite the heavy damage.

Overall, the Ukrainians managed to lure the Russians to expose their forces in the open to discover their critical infrastructure, resulting in a series of devastating precision strikes. Intensification of Ukrainian assaults in Tyotkino incursion will inevitably leave Russians with no other option but to deploy more forces to this area, exposing further forces concentration points to Ukrainian observation and strike teams.

As Ukrainians continue to scout behind Russian lines, additional strikes seem inevitable. Furthermore, as Russians suffer logistical strains by deploying and concentrating so many troops, any movement will be nearly impossible to hide.

https://www.youtube.com/watch?v=_KrxvoQjBvU


16,735 posted on 06/06/2025 5:46:25 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 16728 | View Replies]

To: PIF

“in light of 47’s apparent continual siding with Putin”

I think that Trump has been trying to position himself to where a deal with Putin is possible - which is a tough contortion, given the extreme position Putin has gotten himself.

After a million casualties, squandering so much wealth, and making Russians feel like pariahs around the world, it is politically infeasible for Putin to just say “never mind” and reverse course. He is way out on a limb, and needs a lot of political cover to have any chance of walking back his position.

As Sun Tzu says in the Art of War, Build your enemy a golden bridge, to retreat over. Make it easy for them - at least feasible.


16,736 posted on 06/06/2025 5:50:51 AM PDT by BeauBo
[ Post Reply | Private Reply | To 16734 | View Replies]

To: AdmSmith; FtrPilot; PIF; BeauBo; blitz128; BroJoeK; marcusmaximus; USA-FRANCE; alexander_busek; ...

Today it is interesting to see that 2 of my recent observations and predictions seem likely to be true.

Recent information from a NATO official says Russia’s total casualty rate versus the killed in action rate is around 1140 to 975. Thus more that 80% of Russia’s casualties seem to be dead. I had ventured the cautious estimate that based on reports, videos, and photos it would appear Russian KIAs should be more than 50%. I had also suggested that the most recent attack on the Kerch Bridge might indicate plans to increase Ukraine’s attacks on Crimea. Today’s report of massive missile attacks on Crimea seem to support this opinion. The massive attacks directed at Kursk and south of Belgorod indicate the recent Russian attacks on the Sumy/Karkiv area are being avenged.

President Trump might not even have to increase the sanctions to get more reasonable responses for peace from Putin. I hope the true information about KIA rate for Russian soldiers can be transmitted to the Russian people. Russian polls already indicate a steady lowering of Russian approval for this undeclared Putin war. Do we still have the Voice of America that used to transmit such useful information to countries that tried to keep their people ignorant?


16,737 posted on 06/06/2025 6:01:43 AM PDT by gleeaikin (Question Authority: report facts, and post their links)
[ Post Reply | Private Reply | To 16722 | View Replies]

To: AdmSmith; SpeedyInTexas; marcusmaximus

Unless Putin drastically cuts back on meat wave assaults, in about a week he can announce that there have been a MILLION Russian casualties, and that between 800,000 and 900,000 of them are probably now dead. What lovely information to report to his people around his June 12 celebration event date. May his people rise in protest to defend their loved ones and families from this ill advised NON WAR’s continuation.


16,738 posted on 06/06/2025 6:09:51 AM PDT by gleeaikin (Question Authority: report facts, and post their links)
[ Post Reply | Private Reply | To 16723 | View Replies]

To: AdmSmith; BeauBo

It does appear based on this June 6 loss chart Russia will indeed have it’s MILLION casualties by either June 11th or 12th. Just in time for Putin’s June 12 event, unless he makes a fast move to total peace before then.


16,739 posted on 06/06/2025 6:28:14 AM PDT by gleeaikin (Question Authority: report facts, and post their links)
[ Post Reply | Private Reply | To 16728 | View Replies]

To: PIF; BeauBo

“Sometimes you see two young children fighting like crazy.”

Then you take a closer look and realize that one child is bigger and older and is actually a bully. When the little guy lands a lucky punch and bloodies the bully’s nose you smile in approval. That is if you are a fair and reasonable person.

Regarding Putin’s possible sex related threat he might hold over our President’s head. Have you seen Musk’s latest? He indicates President Trump may be withholding the final report on sex criminal Epstein because he, Trump, is listed/described in that report. Will Trump now cancel his welcome to a bunch of immigrants from South Africa? Are farm owners from South Africa reliable friends and US residents like their sponsor?


16,740 posted on 06/06/2025 6:48:46 AM PDT by gleeaikin (Question Authority: report facts, and post their links)
[ Post Reply | Private Reply | To 16734 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 16,701-16,72016,721-16,74016,741-16,760 ... 22,381-22,394 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson