Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 0putinsfolly; 0putinswar; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynow; anydaynowputinwins; anydaynowrussiawins; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; jonputinbot; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 15,901-15,92015,921-15,94015,941-15,960 ... 22,381-22,388 next last
To: AdmSmith; blitz128
There was never a good reason to support Demented Joe Biden and his Ukraine debacle


15,921 posted on 05/19/2025 5:41:52 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15920 | View Replies]

To: blitz128
Something went wrong? Russia reportedly failed to launch its RS-24 Yars ICBM during a planned test on May 19. No footage or confirmation has surfaced—suggesting the launch near Nizhny Tagil may have been aborted or failed mid-flight.

https://x.com/NOELreports/status/1924402294042366414


15,922 posted on 05/19/2025 5:46:43 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 15918 | View Replies]

To: FtrPilot

“It was again tested on December 24, 2013, from the Plesetsk Cosmodrome in northwest Russia.

“On December 26, 2014, the Strategic Forces conducted a successful launch of an RS-24 Yars missile. The missile was launched from a mobile launcher deployed at the Plesetsk test site. Missile warheads were reported to have successfully reached their targets at the Kura test site in Kamchatka. The launch, which was performed with support of the Air and Space Defense Forces, took place at 11:02 MSK (08:02 UTC)

“More than 10 successful launches took place between 2012 and 2022.”


Appears to be a very successful ICBM, as this is the first reported failure.

https://en.wikipedia.org/wiki/RS-24_Yars


15,923 posted on 05/19/2025 6:04:27 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 15922 | View Replies]

To: BeauBo

Somewhere near Kursk.

https://x.com/bayraktar_1love/status/1922037522965635355

Probably taken out by an SDB...don't know if it was ground launched or air launched.

15,924 posted on 05/19/2025 6:14:19 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 15922 | View Replies]

WTH?


To: blitz128

🍈 is watching you ...


15,754 posted on 05/13/2025 12:13:58 PM PDT by PIF (They came for me and mine ... now its your turn)

15,925 posted on 05/19/2025 6:21:55 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15754 | View Replies]

To: FtrPilot

Send more SDBs!

It may rest on the outcome of today’s 10 AM phone call with President Trump.


15,926 posted on 05/19/2025 6:23:07 AM PDT by BeauBo
[ Post Reply | Private Reply | To 15924 | View Replies]

To: PIF
PIF: "Appears to be a very successful ICBM, as this is the first reported failure."

I wonder if the ruzzians are trying to develop conventional warheads for some of their ICBMs.

The weight & CG of a conventional warhead (bomb) would be significantly different than a nuclear warhead.

This would alter the weight & balance of the missile which would impact the flight control software.

15,927 posted on 05/19/2025 6:29:16 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 15923 | View Replies]

To: AdmSmith
💥 German Vector drone corrects several FPVs on a Russian BM-21 "Grad" near the village of Zorya, south of Pokrovsk.

https://x.com/Maks_NAFO_FELLA/status/1924416364409651669

I doubt that the German Vector drone "corrects" the FPVs.

Most likely, the Vector drone locates targets and provides GPS coordinates to the FPV pilot.

15,928 posted on 05/19/2025 6:39:55 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 15927 | View Replies]

To: BeauBo

Maybe: 47 announces success and Putin agrees. Next day massive drone attack on civilians by Russian drones and missiles. War continues.


15,929 posted on 05/19/2025 6:56:53 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 15926 | View Replies]

To: JonPreston
The US must say, this is not our war

AMEN

15,930 posted on 05/19/2025 7:46:37 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15925 | View Replies]


15,931 posted on 05/19/2025 9:32:05 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15930 | View Replies]

To: FtrPilot; BeauBo

It looks like spring in Kursk is really springing, but the undercarriage of that poor bridge is badly sprung.


15,932 posted on 05/19/2025 9:38:24 AM PDT by gleeaikin (Question Authority: report facts, and post their links)
[ Post Reply | Private Reply | To 15924 | View Replies]

To: BeauBo; FtrPilot; AdmSmith; PIF; BroJoeK

While we are awaiting the report on President Trump’s talk with Putin, we can enjoy this video and report on Europe’s latest efforts to make Putin’s oil business more difficult.

“Last Straw! Russian Jets Chased NATO Navy in the NATO Territory!
RFU News- Reporting from Ukraine, May 18, 2025
https://www.youtube.com/watch?v=uWJvyIH5nFw

I am Ukrainian. On this channel I will give you the latest news about the war in Ukraine.

Today, there are interesting updates from the Baltic Sea.

Here, European forces decided to act swiftly following the newest EU sanctions package and detain an oil tanker from the Russian shadow fleet. In response to a planned boarding, Russian forces rapidly escalated the tensions by deploying their fighter jets to threaten the NATO ships from getting close.

A new wave of EU sanctions has directly targeted Russia’s notorious shadow fleet of oil tankers, which is used to bypass Western embargoes. As part of the EU’s 17th sanctions package, 149 vessels have been added to the blacklist for transporting Russian oil in violation of the price cap.

These mostly uninsured tankers will be barred from accessing EU ports and services, including insurance, repairs, and refueling. Among them, 25 were recently tracked in the Baltic and North Sea, where their presence also raises serious environmental and security concerns because of their poor condition. European officials warn that these ships pose not only a pollution risk but also a threat to vital undersea cables and energy infrastructure due to several incidents with torn cables in the past.

Noting the Baltic Sea’s vulnerability to environmental disasters caused by oil spillage, due to its shallow and enclosed nature, the EU has prompted stricter sanctions on the aged and reckless ships of Russia’s shadow fleet. As the EU prepares to expand the sanctions list to over 350 ships in total, it has also moved to authorize visa bans and asset freezes against shadow fleet captains. These measures aim to disrupt Russia’s illicit export routes and limit its wartime income.

Enforcement of the new package began immediately. A Gabon-flagged tanker under the name Jaguar, one of the newly sanctioned vessels, had previously anchored off a Russian port, prompting increased monitoring by NATO forces. After approaching, the ship refused to identify itself and ignored orders from Estonia’s navy to halt and change course. Estonian patrol ships, helicopters, and patrol aircraft responded, with footage confirming the NATO response.

However, as NATO vessels prepared to board the Jaguar for inspection, the Russian Air Force dispatched a Su-35 fighter jet to the ship’s position in a show of force. According to Estonian defense officials, the Russian jet circled the tanker and signaled a clear intention to prevent any potential boarding or seizure.

Immediately, the planned boarding operation was called, as NATO captains and commanders assessed the risk of triggering a direct military clash as too high. An engagement involving NATO fighter jets or naval assets could have resulted in severe and far-reaching consequences. Estonia’s Foreign Minister confirmed that the aircraft briefly violated NATO airspace.

Finland and Lithuania both raised concerns about reckless Russian behavior, with Lithuania’s Prime Minister warning that Russia is clearly demonstrating a willingness to protect the route for its oil with all means, even risking a direct confrontation to protect its shadow oil fleet. With conventional trade routes restricted due to Western sanctions, Russia relies heavily on this fleet of over 600 aging oil tankers to export crude oil to buyers from Asia. These ships operate under obscure flags, are often uninsured, and are designed to operate below regulatory radar, making them critical to sustaining Russian state revenue, directly funding the war in Ukraine. Disruption of these flows would not only cripple Russia’s wartime economy but also erode its global influence.

This incident shows how far Russia is willing to go to defend its economic lifelines, even deploying air assets to intimidate NATO ships. Yet, the imbalance in firepower is obvious. NATO F-35 squadrons routinely patrol the Baltic Sea. In a real engagement, a lone Russian fighter jet would have stood little chance. But recognizing the risks, NATO wisely de-escalated to avoid a direct military engagement between Russia and NATO forces.

Overall, this standoff underscores the EU’s resolve to implement sanctions, which will only intensify. At the same time, Russia is desperate to protect its oil trade and take even higher risks. With additional shadow fleet vessels likely to be sanctioned and better-armed naval patrols preparing future interception missions, Russia’s strategy of hiding its oil trade in plain sight is becoming increasingly untenable. The Jaguar may have escaped for now, but the message from Europe is clear: sanctions will not go unenforced.”


15,933 posted on 05/19/2025 10:13:40 AM PDT by gleeaikin (Question Authority: report facts, and post their links)
[ Post Reply | Private Reply | To 15926 | View Replies]

To: JonPreston
Peace in our time!


15,934 posted on 05/19/2025 11:05:50 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15931 | View Replies]

To: blitz128; FtrPilot

15,935 posted on 05/19/2025 1:14:09 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15891 | View Replies]

To: AdmSmith
The ball is in Zelensky's court


15,936 posted on 05/19/2025 1:18:13 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15935 | View Replies]

To: AdmSmith
Day 1,180 of the Muscovian invasion. 1,040 [average is 825/day], i.e. more than 43 Russians and Norks/h. Vehicles and fuel tanks more than 110% and artillery more than 20% above average. Motorcycles are not counted yet.


15,937 posted on 05/19/2025 1:19:12 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15907 | View Replies]

To: AdmSmith; BeauBo
🇺🇸 Trump: "The war in Ukraine should've remained Europe’s problem — the U.S. shouldn't have intervened."

He says if there's no real progress, the U.S. will hand over the lead role in resolving the conflict to Europe — though he's also open to increasing arms supplies if needed.

https://x.com/NOELreports/status/1924577613839749428

President Trump is also open to increasing arms supplies if needed.

15,938 posted on 05/19/2025 3:14:49 PM PDT by FtrPilot
[ Post Reply | Private Reply | To 15937 | View Replies]

To: FtrPilot

15,939 posted on 05/19/2025 3:15:41 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15938 | View Replies]

The Ball is in Zelensky's Court


15,940 posted on 05/19/2025 3:17:41 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15939 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 15,901-15,92015,921-15,94015,941-15,960 ... 22,381-22,388 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson