Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 15,841-15,86015,861-15,88015,881-15,900 ... 20,161-20,164 next last
To: JonPreston; Sidebar Moderator; admin; JR

Its is not up to you if a thread goes up or dies. Your posts contribute nothing but inane memes and gibberish. You are plagiarizing others work by not linking or identifying the origin or source or original poster. All of which detracts and damages the thread, and the site as a whole.


15,861 posted on 05/17/2025 7:34:34 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 15860 | View Replies]

To: PIF
Actions like yours are one of the main reasons FR finds it difficult to get timely donations.

That's rich.

15,862 posted on 05/17/2025 7:44:21 AM PDT by going hot (Happiness is a Momma Deuce)
[ Post Reply | Private Reply | To 15859 | View Replies]

To: PIF

This isn’t your Thread and this isn’t your forum. Stop complaining and go enjoy your Saturday.


15,863 posted on 05/17/2025 7:46:28 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15861 | View Replies]

To: PIF
OSINT researcher Ben Reuter has discovered that the Russians have begun painting silhouettes of their latest Su-57 fighter jets on airfields as decoys for Ukrainian long-range strikes.

https://bsky.app/profile/maks23.bsky.social/post/3lpedsnlyrk25

paintings do not cast shadows

15,864 posted on 05/17/2025 8:00:50 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15854 | View Replies]

To: BeauBo

Russia lost 50,000 troops trying to take a Ukrainian town with 48 residents—but still failed
Ten months, 50,000 casualties, and still no breakthrough in Toretsk.

Once home to some 30,000 residents in Donetsk Oblast, Toretsk is now nearly completely destroyed due to relentless Russian shelling. Before the war, it was a thriving industrial town with coal mines, a processing plant, a bakery complex, and several factories. Today, only 48 residents remain, according to regional authorities.

https://euromaidanpress.com/2025/05/17/russia-lost-50000-troops-trying-to-take-a-ukrainian-town-with-48-residents-but-still-failed/


15,865 posted on 05/17/2025 8:39:34 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15803 | View Replies]

To: AdmSmith

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

The complete transcript.

[ Just in Time! Thousands of Latvian Drones Flood The Front Line! ]

Today [ May 16, 8 pm ], there is interesting news from the Pokrovsk direction ... the international effort to support Ukraine’s fight against Russia, led by the Drone coalition, with Latvia at its forefront is set to deliver 12,000 drones this year already by June. As a result, the deadliest drone brigade, Magyar’s Birds, responsible for the hottest part of the frontline has already decimated multiple brigades of the Russian vanguard.

The Drone Coalition was officially formed in early 2024 under the Ukraine Defense Contact Group. Co-led by Latvia and the United Kingdom, this international initiative was created to supply Ukraine with massive quantities of unmanned aerial vehicles, electronic warfare systems, and supporting technologies.

Now composed of 16 countries, including Canada, Australia, France, Germany, Poland, and Sweden, the coalition is supposed to have delivered 1,000,000 drones of various types by February this year.

Among the most active contributors, Latvia has emerged as a pivotal partner in this effort, as the country that started the initiative and coordinated with the UK to get the bigger countries involved. Last year, the country pledged over 5,000 drones, ranging from reconnaissance to FPV strike drones. These are produced by seven Latvian defense firms, highlighting the country’s growing military-industrial capabilities.

By delivering 12,000 drones in the first half of this year, Latvia seems to have almost quintupled its yearly production compared to last year. Backed by a 20,000,000 Euro investment, Latvia’s aid also includes drone operator training and technical support, amplifying the operational effectiveness of Ukrainian drone units across the frontlines.

Nowhere is this support more evident than in the drone-dominated battle space around Pokrovsk, where Ukrainian drone warfare, spearheaded by the Magyar’s Birds drone unit, has devastated Russian logistics and troop movements in thousands. Drone strikes here have crippled supply convoys and positions, enabling Ukrainian counterattacks that secured key ground vital for Pokrovsk’s defense.

Founded by Robert Brovdi, callsign Magyar, it evolved from a small team into a full-fledged brigade, comprising drone pilots, engineers, electronic warfare specialists, and intelligence officers. They operate in decentralized teams, focused on deep surveillance, kamikaze drone strikes, and electronic disruption - often destroying Russian artillery and air defense systems far beyond the frontline.

Latvia’s drones play a direct role in enabling their missions. With FPV drones now being mass-produced and supplied by Latvian companies, Magyar’s Birds can maintain a high operational tempo without fear of depletion. These FPV drones are fast, reliable, and easy to operate, easily adjustable for both direct strikes and reconnaissance.

Integration with Latvia’s training programs ensures operators are not only well-equipped, but also highly skilled, due to the general experience of the unit across some of the hottest frontline points. This level of foreign support has proven to be force-multiplying.

The results speak for themselves, as according to Magyar, the unit now averages a successful strike every 6 1/2 minutes, a rate that continues to rise, as experience and support grow. In total, Magyar’s Birds have inflicted heavy losses on Russian personnel and equipment, with Magyar himself estimating a kill to loss ratio of around 1,000 enemy combatants for each drone operator lost.

Regarding confirmed kills, in the first 10 days of April alone, Magyar’s Birds managed to eliminate 564 Russian soldiers and wound 311 other targets, which means that 1 Ukrainian drone brigade is eliminating 1 full Russian assault brigade every 4 weeks. Beyond direct battlefield impact, the unit releases constant video footage of their operations, serving a psychological warfare function by sowing fear and hesitation among Russian forces and potential recruits.

Overall, the success of Ukraine’s drone warfare efforts underscores the critical importance of the Drone Coalition’s work. With Latvia multiplying its production numbers 5-fold in just one year, its support, and that of other allied nations, remains vital for Ukrainian forces to stay ahead in drone warfare.

It enables frontline units like Magyar’s Birds to dominate key sectors such as Pokrovsk, denying the Russians initiative and exhausting their combat strength. With new technologies, such as drones with fiber-optic connections offering fire control regardless of enemy electronic warfare, the potential exists to strike deeper and harder than ever before.

https://www.youtube.com/watch?v=EpGSCCCPQKI


15,866 posted on 05/17/2025 9:13:24 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 15865 | View Replies]

To: JonPreston; Sidebar Moderator; admin; JR

This isn’t your Thread and this isn’t your forum. Stop complaining


Stop abusing the thread and the forum


15,867 posted on 05/17/2025 9:29:52 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 15863 | View Replies]

To: marcusmaximus

“Putin’s peace talks negotiator claimed Russians have extra chromosome”

What a clown show the Russians have become under Putin.


15,868 posted on 05/17/2025 9:44:04 AM PDT by BeauBo
[ Post Reply | Private Reply | To 15841 | View Replies]

To: BeauBo

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

The complete transcript.

[ Tide Has Turned Again! Ukrainians Push Deeper Into Kursk! ]

Today [ May 16, 8 pm ], there are a lot of important updates from the Kursk direction ... the Ukrainians are intensifying their offensive operations along the Russian border near Tyotkino. As Ukrainian forces pushed deeper into Kursk, powerful HIMARS and strikes of the Ukrainian Air Force played a critical role in turning the tide and setting the stage for further Ukrainian assaults, coming increasingly close to capturing another tactically valuable settlement.

The Ukrainian forces continued with their border incursion towards Tyotkino.

Strategically, this operation aims to divert the Russian attention away from their summer campaign in the Donbas and keep them tied to the Kursk region.

Tactically, this is meant to stretch the Russian defenses further to expose their vulnerabilities for additional Ukrainian counterattacks in Kursk.

The Ukrainian attack at Novy Put, where they exploited a gap in the dragon’s teeth fortifications, divided Russian attention. This allowed Ukrainians to increase the pressure elsewhere and continue pressuring the tactically significant settlement of Tyotkino, which would significantly improve Ukrainians’ positioning.

By controlling Tyotkino, the Ukrainian forces could shorten their border defenses by over 15km. Securing the settlement would also allow the Ukrainian forces to use the residential houses to deploy and conceal lots of soldiers and heavy equipment in the area, making it difficult for the Russians to identify or target them.

Additionally, Tyotkino is right next to the Ukrainian border and very distant from the main Russian logistics hub at Glushkovo, exposing the deployment of Russian reinforcements along open roads, undermining the Russians’ offensive and defensive capabilities.

To take the settlement, the Ukrainians intensified their HIMARS strikes, denying Russians the artillery support needed to overwhelm Ukrainian ground assaults. Geolocated footage from the area reveals how the Ukrainians detected a North Korean Juche multiple-launch-rocket-artillery system, and relayed the location to a nearby HIMARS battery.

The North Korean system was subsequently destroyed with pinpoint accuracy, as the HIMARS projectile ignited the ammo and destroyed the system. On top of that, the Ukrainian Air Force conducted precision strikes to eliminate Russian forces’ concentrations and fortifications in Tyotkino and clear the way for frontline assaults.

The Ukrainian aircraft managed to conduct 3 successful strikes on Russian positions at Tyotkino train station, eliminating Russian forces with utmost precision, and exposing a weak point for direct Ukrainian attack towards it.

Afterwards, the Ukrainians deployed FPV drones to scout the area for any concealed Russian armored vehicles hidden in abandoned buildings, leading to the destruction of multiple Russian T-72-B3 tanks, denying Russian infantry armored support for the defense.

The activity of Ukrainian MiG-29s in this area implies the Ukrainians successfully suppressed Russian air defense systems during the early stages of their incursion, meaning that many more air strikes could be conducted in the future. With the success of HIMARS batteries and the Air Force doing massive damage to Russian combat capabilities, ground assault units were poised to make another breakthrough.

The Ukrainian assault groups advanced in the southwestern part of Tyotkino. They secured the fields to the southeast, entering the first streets in the town that would serve as a staging ground for further operations. Geolocated evidence also indicates that Ukrainians have cleared the mines on the road and were able to move armored vehicles past the anti-tank ditches and into the town.

If Russians want to stop Ukrainians from continuously launching incursions and attacks across the region, they would have to divert to their tactics of continuous small infantry group assaults to pin Ukrainians down. Doing this over such a massive part of the frontline would drain similar resources to Russian efforts at Pokrovsk, equating to hundreds of Russian soldiers a day. So even if Russians manage to halt Ukrainian attacks, the cost of doing that alone would put a massive drain on their manpower reserves, allocated to their summer offensive in the east.

Overall, the Ukrainians are continuing with their border-pressuring campaign, increasing the intensity of their assaults and advancing against poorly prepared Russian border units in Tyotkino. With intense fire from Ukrainian HIMARS units and the air force silencing Russian guns, Ukrainian infantry and mechanized units have been able to continue to press forward the advance, creating another problem for Russian commanders in Kursk to deal with.

To hold the Ukrainians and prevent further incursions Russian command will be forced to maintain a significant force in the Kursk sector this will be needed to maintain pressure and deny Ukrainians the initiative simultaneously draining critical reserves desperately needed for Russian offensive plans in eastern Ukraine.

https://www.youtube.com/watch?v=nuKeJ84EDZk


15,869 posted on 05/17/2025 9:47:22 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 15868 | View Replies]

To: PIF; AdmSmith

President Trump scheduled to talk with Putin by phone on Monday, 19 May.

Kyiv Independent reports:

“”Honestly, I will (impose sanctions), if we’re not gonna make a deal,” Trump told Fox News’ Bret Baier in an interview published on May 16. “This is turkey time, we’re talking turkey, and we’ll see what happens. This would be crushing for Russia because they’re having a hard time now with the economy, oil prices are low.”...

...Russia has so far rejected a truce four times — on March 11, March 25, May 11 and the most recent one on May 16 in Istanbul.


15,870 posted on 05/17/2025 10:08:10 AM PDT by BeauBo
[ Post Reply | Private Reply | To 15869 | View Replies]

To: BeauBo
🍈

President Trump scheduled to talk with Putin by phone on Monday, 19 May.

Thank you President Trump

Every time we edge closer to Peace, Neocons act out in anger.

15,871 posted on 05/17/2025 10:27:55 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15870 | View Replies]

To: JonPreston

If putin does not agree to cease fire on Monday, and Trump drops the bone-crushing sanctions on Russia, the likely response by putin will be to re-Sovietize Russia to an even more marked degree (extensive central planning and control, and more repressive restrictions on individuals, perhaps rationing), and to print rubles at a hyper-inflationary rate (6-12 month delay till the full inflationary effects manifest).

In 2022, people thought that putin would drag Ukraine back into the Soviet Union, but in 2025, it is clear that it is Russia that is being dragged back into the Soviet Union.


15,872 posted on 05/17/2025 10:57:49 AM PDT by BeauBo
[ Post Reply | Private Reply | To 15871 | View Replies]

To: BeauBo
If putin does not agree to cease fire on Monday, and Trump drops the bone-crushing sanctions on Russia

That would be Sanctions, Round 17, all of which affected the EU far more than Russia

Putin isn't concerned and if DJT did that he'd own Biden's war, lock, stock and barrel.

It's not happening

15,873 posted on 05/17/2025 11:05:09 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15872 | View Replies]

To: JonPreston

“It’s not happening”

Stop trying to impede President Trump’s efforts to compel belligerent Russia to cease fire.

President Trump says he will do it. I believe him.

“Honestly, I will (impose sanctions), if we’re not gonna make a deal,” Trump told Fox News’ Bret Baier in an interview published on May 16. “This is turkey time, we’re talking turkey, and we’ll see what happens. This would be crushing for Russia because they’re having a hard time now with the economy, oil prices are low.”

Bone-crushing, Trump-style sanctions.


15,874 posted on 05/17/2025 11:15:38 AM PDT by BeauBo
[ Post Reply | Private Reply | To 15873 | View Replies]

To: BeauBo

Ceasefire, or else.

Kyiv Independent:

“U.S. President Donald Trump said he will be speaking, by telephone, to President Vladimir Putin of Russia on Monday, at 10 a.m....

...”The subjects of the call will be stopping the ‘bloodbath’ that is killing, on average, more than 5,000 Russian and Ukrainian soldiers a week, and trade,” he wrote on Truth Social.

“I will then be speaking to President Zelensky of Ukraine and then, with President Zelensky, various members of NATO,” he added. “Hopefully it will be a productive day, a ceasefire will take place, and this very violent war — a war that should have never happened — will end. God bless us all!!!””


15,875 posted on 05/17/2025 11:20:39 AM PDT by BeauBo
[ Post Reply | Private Reply | To 15874 | View Replies]

To: BeauBo
Stop trying to impede President Trump’s efforts

This might come as a shock to you, but President Trump doesn't follow my posts here on tFR, so I can't really impede him with what I write, can I? But you know that and your comment is a childish attempt to stir the pot. Anyone who posts on this Thread can see thru your habits. No, new sanctions won't happen, and you'd be wise not to spin around in circles as DJT postures in public with his negotiation.

15,876 posted on 05/17/2025 11:32:41 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15874 | View Replies]

Partisan divide continues among Americans on support for NATO

Partisan divide continues among Americans on support for NATO

20 April 2025

According to a Pew Research Center poll, Democrats are much more likely than Republicans to have a positive opinion of NATO.

About two-thirds of Americans (66%) say the US benefits a great deal or a fair amount from NATO membership—down from 71% in 2021—while 32% say it does not benefit much or at all. This drop is reflected among Republicans (down 6 points) while opinion among Democrats has held steady.

There has been a wide partisan gap in US opinions of NATO in recent years, as confirmed in this latest poll. About three-quarters of Democrats and Democratic-leaning independents (77%) express a positive view of the organization, while 45% of Republicans and Republican leaners feel this way. Neither partisan group has shifted significantly in their views over the past year.

The poll also found that Republicans have become less likely to say Russia is an enemy of the United States over the past year, and they are more likely to describe it as a competitor. Around half of Americans describe Russia as the enemy, while in 2024, 61% of respondents said the same thing.

About 40% of Republicans called Russia an enemy of the US, down from 58% in 2024. Among Democrats and Democratic-leaning independents, the figure has dropped from 67% to 62% during the same time.

The poll was conducted 24-30 March 2025 among 3,605 US adults. The margin of error was 1.9 percentage points.


15,877 posted on 05/17/2025 11:36:27 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15876 | View Replies]

To: BeauBo

https://www.pewresearch.org/global/2025/04/17/republican-opinion-shifts-on-russia-ukraine-war/

15,878 posted on 05/17/2025 12:10:44 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15875 | View Replies]

To: AdmSmith
From your link. Republicans starting to see Russia as a competitor, not as an enemy


15,879 posted on 05/17/2025 12:25:33 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15878 | View Replies]

To: PIF



15,880 posted on 05/17/2025 12:30:17 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15869 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 15,841-15,86015,861-15,88015,881-15,900 ... 20,161-20,164 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson