Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 15,741-15,76015,761-15,78015,781-15,800 ... 20,201-20,211 next last
🍈

dopey, If I wanted this thread gone I wouldn't ping you and others to comments, would I? Tomorrow will be a busy day in Istanbul. I'd like you to keep us abreast of the happenings, especially as related to Dictator Zelensky. Like a spoiled kid, his potential to be the turd in the punch bowl is enormous.

15,761 posted on 05/14/2025 5:02:43 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15758 | View Replies]

To: AdmSmith

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

The complete transcript.

[ New Ukrainian Incendiary Drones Leave Nothing But Ash! ]

Today [ May 13, 8 pm ], there are a lot of important updates from the Pokrovsk direction. Here, a Russian mechanized column barely cleared its staging area before Ukrainian incendiary drones swooped immediately to engage them. The strike caught the vehicles in the open, setting equipment and fuel ablaze in mere minutes before the assault had even started.

The goal of the Russian forces in this area is to establish a foothold in Myrnograd to initiate large-scale urban combat in the Pokrovsk-Myrnohrad agglomeration. This is because the southern part of Myrnohrad is distant and detached from the core part of the city, where the bulk of Ukrainian forces are stationed, making it more vulnerable to Russian assaults.

To establish a foothold in Myrnohrad the Russians decided to accumulate forces in Hrodivka from which they would launch a direct mechanized assault towards the town. This is enabled by a 5 km section of a paved asphalt road between Hrodivka and Myrnohrad, allowing the Russian tanks and BMPs to utilize their full speed to reach the city and dismount stormtroopers for urban fighting quickly.

The main tactical disadvantages of the Russian forces in this area is the industrial zone of the nearby coal mine in the southern part of Myrnohrad, which includes high-rise buildings of mineshaft elevators that provide fortified concrete observation points that overlook the Russian route of attack.

Additionally, two elevated terrikons in the area allow for additional observation points to overlook all Russian movements around Myrnohrad, together with firing positions.

Forward Ukrainian positions in the fields before the city include 2 powerful strongholds built in 2015 and heavily reinforced with concrete bunkers, trenches, and dugouts overlooking the Hrodivka road.

Any Russian advance along this route faces deadly ATGM fire from these fortifications. To compound the threat, Ukrainian engineers have scattered anti-tank mines across the road, forcing Russian units to slow and use mine rollers on their lead vehicles, which exposes them further to Ukrainian strikes.

To properly advance and evade Ukrainian fire the Russians would need to maneuver across the fields; however, the Ukrainians anticipated this and built a network of anti-tank ditches and dragon teeth across the fields, effectively turning the Russian road of attack into a kill zone.

This means that the Russians would be forced to attack Myrnohrad by driving slowly along the paved road and deactivating anti-tank mines, since the surrounding fields are covered with anti-tank ditches and dragon teeth, while the Ukrainians positioned at the terrikon, industrial zone, and trench strongholds, have a firing solution on them.

Geolocated combat footage from the area reveals how a Russian mechanized platoon, consisting of a tank and 2 BMPs, was immediately detected by the Ukrainian forces stationed at observation points as soon as they left Hrodivka, and exposed themselves on the road. The lead tank was equipped with a mine roller, with the rest of the convoy moving slowly, meaning that Ukrainians detected them within minutes.

As the Russians just started their assault and were not yet within range of Ukrainian soldiers at trenches and terrikon that are armed with ATGM, the Ukrainian FPV drone operators immediately reacted and struck the Russian vehicles engines, effectively immobilizing them.

This led to a panic among Russian soldiers in the convoy as they thought that they would advance faster, if they moved on foot rather than vehicles, only to expose themselves to Ukrainian FPV drones right after leaving their tanks and BMPs, leading to quick eliminations, while others fled to the rear.

This left the Russian vehicles abandoned and damaged, but at risk of possible recovery by the nearby Russian forces, so the Ukrainian drone operators targeted open hatches left by the Russian vehicle crews with incendiary drone-dropped grenades that finished them off and blew them up.

Overall, the Russians launched a poorly calculated assault that almost completely ignored the strong networks of fortifications made by the Ukrainians, which forced the Russians in a narrow kill zone where the Ukrainians destroyed an entire mechanized platoon in minutes.

This assault is direct result of the intensification of Russian assaults across the Pokrovsk direction, and it is the first Russian mechanized assault here, after months of stalemate near Myrnohrad, meaning that attacks here will continue shortly.

https://www.youtube.com/watch?v=g7nyMqD8yvE


15,762 posted on 05/14/2025 5:02:45 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 15760 | View Replies]

To: PIF

***BREAKING***

Candid Image Gives First Evidence Of China’s Secretive Armed Underwater Drone https://t.co/VTe3s4S0IU— H I Sutton (@CovertShores) May 14, 2025


15,763 posted on 05/14/2025 5:27:19 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15762 | View Replies]

To: blitz128
TOP ATTACK: Ukraine is fielding UCAVs armed with RPG-18 single shot anti-tank rocket launchers. Effective against armored personnel carriers, main battle tanks in top attacks and light vehicles.

https://x.com/ChuckPfarrer/status/1922618883661262992


15,764 posted on 05/14/2025 6:00:57 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 15758 | View Replies]

To: BeauBo
INCOMING: @NOELreports provides this Russian video of two Ukrainian GBU-39 small diameter bombs slamming into a bridge near their positions. If the weapons has been aimed at them-- they’d have become the rarest gas in the universe, Vatnikium-165.

https://x.com/ChuckPfarrer/status/1922630232349016170

Perhaps the GLSDB jamming issue has been solved.

15,765 posted on 05/14/2025 6:11:46 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 15764 | View Replies]

To: BeauBo; blitz128
Day 1,175 of the Muscovian invasion. 1,240 [average is 824/day], i.e. more than 51 Russians and Norks/h. Vehicles and fuel tanks more than 205% and artillery more than 95% above average. Motorcycles are not counted yet.


15,766 posted on 05/14/2025 6:25:21 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15732 | View Replies]

To: blitz128

Apparently, you’re living rent free in someone’s head.


15,767 posted on 05/14/2025 7:49:23 AM PDT by Mr. Lucky
[ Post Reply | Private Reply | To 15758 | View Replies]

To: FtrPilot

“Perhaps the GLSDB jamming issue has been solved.”

If that is the case, we should be hearing more about them in the coming weeks (if the war even continues that long, due to the threat of President Trump’s secondary sanctions).


15,768 posted on 05/14/2025 7:50:37 AM PDT by BeauBo
[ Post Reply | Private Reply | To 15765 | View Replies]

To: Mr. Lucky

Jeepers Mr Lucky 🍀 where have you been?


15,769 posted on 05/14/2025 7:59:00 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15767 | View Replies]

To: Mr. Lucky

Someone doesn’t understand that others have lives outside trolling threads😂🤡


15,770 posted on 05/14/2025 8:30:40 AM PDT by blitz128
[ Post Reply | Private Reply | To 15767 | View Replies]

To: blitz128

15,771 posted on 05/14/2025 9:52:40 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15770 | View Replies]

To: LowIQ
🍈

🚨 HOLY SMOKES: Trump takes a blow torch to the neocons and interventionists while speaking to the Saudis. This is a VICTORY speech over globalism.

"It's crucial for the wider world to know this great transformation has not come from Western interventionists, or flying people… pic.twitter.com/mN0Q9pbhWP— Eric Daugherty (@EricLDaugh) May 13, 2025

HOLY SMOKES: Trump takes a blow torch to the neocons and interventionists while speaking to the Saudis. This is a VICTORY speech over globalism.

"It's crucial for the wider world to know this great transformation has not come from Western interventionists, or flying people in beautiful planes giving you lectures on how to live and how to govern your own affairs."

"In the end, the so-called nation builders wrecked far more nations than they built and the interventionalists were intervening in complex societies that they did not even understand themselves."

"No, the gleaming marvels of Riyadh and Abu Dhabi were not created by the so-called 'nation builders,' neocons, or liberal non-profits like those who spent trillions and trillions of dollars failing to develop Baghdad, so many other cities."

"Instead, the birth of a modern Middle East has been brought by the people of the region themselves, the people that are right here, the people that have lived here all their lives, developing your own sovereign countries, pursuing your own unique visions and charting your own destinies in your own way."

"They told you how to do it, but they had no idea how to do it themselves. Peace, prosperity, and progress ultimately came not from a radical rejection of your heritage, but rather from embracing your national traditions and embracing that same heritage that you love so dearly."

"You achieved a modern miracle the Arabian way."

No wonder they respect him so much.

15,772 posted on 05/14/2025 9:58:38 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15771 | View Replies]

To: JonPreston

He makes some good points in that speech, but a big difference between Baghdad and Riyadh or Abu Dhabi, is that Baghdad (like Damascus) is ground zero for the Sunni/Shia conflict, and Baghdad (also like Damascus) suffered from decades of pro-Soviet Socialist rule under the Ba’ath Party.


15,773 posted on 05/14/2025 10:25:29 AM PDT by BeauBo
[ Post Reply | Private Reply | To 15772 | View Replies]

To: blitz128; USA-FRANCE
Ringleader of Bulgarian spy cell jailed for 10 years 8 months

Six Bulgarian nationals convicted of spying for Russia have been sentenced to between five and ten years in jail. Mr Justice Hilliard said the group's activities risked the safety and interests of the UK. The group, directed on behalf of Russian intelligence services by Jan Marsalek, an Austrian fugitive, conducted surveillance operations on targets of interest to the Kremlin, including investigative journalists and Russian dissidents. Roussev and Marsalek plotted to kidnap and murder some of those targets, though these plans were never realised.

Marsalek is reported to be in Moscow after fleeing fraud charges in Germany following the collapse of payments processing company Wirecard, for which he was the chief operating officer. Conspiracy to spy carries a maximum sentence of 14 years, but Roussev, Dzhambazov and Stoyanov were afforded some credit for their guilty pleas ahead of a trial in which Ivanova, Gaberova and Ivanchev were convicted.

In his sentencing remarks, Mr Justice Hilliard said using the UK as a base to plan spy operations was a “very serious offence” which “undermines this country's standing with allies”. “Targeting journalists… undermines freedom of the press, one of our core democratic values,” he added.

more info: https://www.bbc.com/news/live/c39xkevzrdvt

7JUN2021 Wirecard: German Parliament slams Scholz and Merkel
The public inquiry into the Wirecard scandal published its concluding report on Monday, criticizing Germany's Finance Minister Olaf Scholz and Chancellor Angela Merkel.

The parliamentary committee consisting of opposition lawmakers ended a monthslong investigation into the scandal with the publication of a 675-page draft report. The report called out Scholz, who is also the chancellor candidate for the Social Democrats, for his oversight and mishandling of the biggest fraud scandal in post-war Germany.

“Olaf Scholz as finance minister bears political responsibility for the failure of BaFin,” the report said. BaFin is Germany's financial regulator and part of Scholz’s ministry. The committee also said that Merkel had been naive about the lobbying efforts by Wirecard.

https://www.dw.com/en/wirecard-german-parliament-slams-scholz-and-merkel/a-57800993

15,774 posted on 05/14/2025 10:27:04 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15770 | View Replies]

To: BeauBo; AdmSmith; PIF; FtrPilot; blitz128; BroJoeK; USA-FRANCE; marcusmaximus

It seems to me that Saudi Arabia, and the other hyper developed small ME countries have the advantage of low population relative to huge oil resources. This enables them to pay for expert outside information and creativity. In addition they are also able to hire large numbers of lower level workers from second and third world companies to do all the low level and ordinary day to day labor or organization maintenance work.

The children of the elite can be sent to high quality overseas education institutions, and subsequently have the luxury of time to dream and create, if they don’t fall into the lure of party, party, party. Fortunately, some of these countries have a strong desert heritage of leadership and responsibility for the tribe which also helps their development. This may work better where the population of the elites is small enough for good communication and common resolve. The areas where there is not a strong Sunni/Shia conflict benefit from that lack.


15,775 posted on 05/14/2025 11:14:06 AM PDT by gleeaikin (Question Authority: report facts, and post their links)
[ Post Reply | Private Reply | To 15773 | View Replies]

To: AdmSmith; BeauBo; blitz128; PIF

Given the May 14 casualty figures show here of almost 970,000, it appears the Russians you reported on earlier today are underestimating their loses by almost 200,000. Is this accuracy, or reflective of a desire to keep the bad news to a minimum. Or does it reflect close to 200,000 unrecovered bodies they will never report on or return to the grieving loved ones and communities.


15,776 posted on 05/14/2025 11:24:18 AM PDT by gleeaikin (Question Authority: report facts, and post their links)
[ Post Reply | Private Reply | To 15766 | View Replies]

To: FtrPilot

They were updated, with shipments to Ukraine resuming in March. But Ukraine also receives air launched GBU-39s, which were not susceptible to jamming and have been in continuous use.

https://www.twz.com/land/ground-launched-small-diameter-bomb-headed-to-ukraine-for-its-second-try-at-combat-report


15,777 posted on 05/14/2025 11:51:53 AM PDT by ETCM (“There is no security, no safety, in the appeasement of evil.” — Ronald Reagan)
[ Post Reply | Private Reply | To 15765 | View Replies]

To: gleeaikin
In addition they are also able to hire large numbers of lower level slave workers from second and third world companies
15,778 posted on 05/14/2025 11:55:50 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 15775 | View Replies]

To: gleeaikin

The numbers are casualties wounded/dead, not just dead


15,779 posted on 05/14/2025 11:57:03 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 15776 | View Replies]

To: PIF; AdmSmith; BeauBo

I am specifically responding to the apparent undercount of casualties of around 180,000. I have been scheptical of their figures of dead, and I suspect most of the difference is made up of uncounted dead. Having read the comments and looked at a lot of the videos, I feel the Russians are seriously undercounting their number of dead. It seems that many of the reports show almost all of a meat wave being killed systematically by Ukraine drones, even flying into houses to kill the few escaped. Under these conditions, I suspect little collection of the dead is being made. Otherwise those collecting would also be killed. I think the Russian military has a severe lack of Marine comrade ethics.

In my comment regarding contract labor in those countries, I prefer to be diplomatic. After all President Trump IS trying to line up a $trillion in contracts for projects to be done in the United States.


15,780 posted on 05/14/2025 2:00:58 PM PDT by gleeaikin (Question Authority: report facts, and post their links)
[ Post Reply | Private Reply | To 15779 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 15,741-15,76015,761-15,78015,781-15,800 ... 20,201-20,211 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson