Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 15,681-15,70015,701-15,72015,721-15,740 ... 20,241-20,259 next last
šŸˆ


15,001 posted on 04/19/2025 6:00:31 AM PDT by JonPreston ( ✌ ā˜®ļø )

15,701 posted on 05/11/2025 12:49:11 PM PDT by JonPreston ( ✌ ā˜®ļø )
[ Post Reply | Private Reply | To 15700 | View Replies]

To: AdmSmith

Breaking: ⚔Wild Card Redneck just got the big Zot for his vicious attacks on JR and others


15,702 posted on 05/11/2025 12:55:06 PM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 15682 | View Replies]

To: JonPreston

What an obnoxious idiot. šŸ˜…šŸ¤£šŸ˜‚šŸ¤£šŸ˜†šŸ¤£šŸ¤£šŸ˜…
His 5 inch high heels would go well with his open arse fly costume.
I assume it’s easy access when he hangs with his wanker wagging boys.


15,703 posted on 05/11/2025 1:36:15 PM PDT by ANKE69 ( šŸ‡ŗšŸ‡² )
[ Post Reply | Private Reply | To 15694 | View Replies]

To: PIF

He really asked for it.


15,704 posted on 05/11/2025 2:58:01 PM PDT by BeauBo
[ Post Reply | Private Reply | To 15702 | View Replies]

To: gleeaikin; FtrPilot
Russian Offensive Campaign Assessment, May 11, 2025

Putin also continues to demand that any negotiations address Russia's perceived ā€œroot causesā€ of the war in Ukraine. Putin stated during the press conference that the purpose of renewed bilateral Russian-Ukrainian negotiations would be to ā€œeliminate the root causesā€ of the war in Ukraine.[6] Putin suggested that Russia and Ukraine could pursue a ceasefire as part of these renewed negotiations, but claimed that a ā€œreal truceā€ should not enable the ā€œrearmamentā€ and ā€œreplenishmentā€ of the Ukrainian military. The Kremlin has repeatedly claimed that Russia must eliminate the ā€œroot causesā€ of the war in Ukraine, which Russian officials have defined as NATO's alleged violation of commitments not to expand into Eastern Europe and along Russia's borders in the 1990s, 2000s, and 2010s, and the Ukrainian government's alleged discrimination against ethnic Russians and Russian language, media, and culture in Ukraine.[7] Kremlin officials recently claimed that any ceasefire agreement should limit Ukraine's ability to mobilize and train new troops and receive Western military aid, while failing to offer similar concessions for Russia to limit its own force generation and defense production efforts.[8] Calls for the elimination of these alleged ā€œroot causesā€ and limitations on Ukraine's force generation capabilities are in line with Putin's demands for Ukrainian neutrality, as well as Putin's pre-war demand that would have required NATO to roll back to its pre-1997 borders.[9]

Putin is attempting to manipulate ongoing discussions about a ceasefire and future peace in Ukraine, likely in an effort to undermine Ukrainian-US-European unity around a comprehensive 30-day ceasefire in Ukraine. Kremlin officials have recently intensified their engagement with Western media in an effort to message directly to the Trump administration and American public and portray Russia's terms for Ukraine's surrender as reasonable.[10] Putin's May 11 press conference and Kremlin Spokesperson Dmitry Peskov’s recent interviews with Western media are part of an attempt to inject Kremlin narratives into the Western information space aimed at convincing the West that Russia is able to conquer all of Ukraine militarily and scaring Ukraine and the West into conceding to Russia's demands.[11] Putin's rhetorical posturing is an attempt to conceal limitations in the Russian military's capabilities and distract from Russia's failure to make any significant progress on the battlefield over the last two years. Putin and other Kremlin officials firmly maintain their war aims that amount to Ukraine's full capitulation and have thus far refused to consider any peace deal that does not concede to all of Russia's demands.[12] The Kremlin is falsely portraying itself as willing to engage in good-faith negotiations with Ukraine while continuing to attack frontline Ukrainian positions and setting conditions for further military aggression against Ukraine and NATO in the coming years.

Ukrainian President Volodymyr Zelensky and Turkish President Recep Tayyip Erdogan accepted Russian President Vladimir Putin's proposal to hold bilateral negotiations in Turkey on May 15. Zelensky stated that he will personally wait for Putin in Turkey and that Ukraine is waiting for Russia to agree to the US-Ukrainian-European general ceasefire proposal.[13] Putin discussed renewing the 2022 Istanbul negotiations in a call with Erdogan on May 11, and Erdogan expressed support for resuming talks.[14] Erdogan noted during his call with Putin that a comprehensive ceasefire would ā€œcreate the necessary environmentā€ for peace talks.[15] European officials largely called on Putin to agree to a comprehensive ceasefire agreement before beginning bilateral peace negotiations with Ukraine.[16]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-may-11-2025

15,705 posted on 05/12/2025 12:24:07 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15668 | View Replies]

To: BeauBo; blitz128
Day 1,173 of the Muscovian invasion. 1,170 [average is 824/day], i.e. more than 48 Russians and Norks/h. Vehicles and fuel tanks more than 315% and artillery more than 100% above average. Motorcycles are not counted yet.


15,706 posted on 05/12/2025 2:11:35 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15669 | View Replies]

To: AdmSmith

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

The complete transcript.
—

[ Ukrainians Ambush Sleeping Russian Soldiers! ]

Today [ May 11, 8 pm ], there are a lot of important updates from the Pokrovsk direction. Here, under the cover of darkness, Ukrainian forces launched sudden night raids near Uspenivka, including a high-speed machine gun drive-by that stunned Russian troops. These bold strikes set the stage for a swift and coordinated effort to break the enemy’s foothold on the flank.

The goal of the Russian forces in this area is to collapse the Ukrainian positions south of Novoserhiivka by cutting off their logistics. The capture of this area would allow the Russians to widen their bridgehead and protect their logistics by establishing stable defenses along the Solona river, exploiting the most vulnerable part of the Ukrainian defense.

To cut off Ukrainian logistics, the Russian forces are trying to infiltrate the houses around Novoserhiivka and position themselves within the village. This would position the Russian fighters along the main Ukrainian supply road to Uspenivka, which the Ukrainians use to deploy their infantry across two nearby bridges on the Solona river from Novoserhiivka.

Furthermore, the hills north of Novoserhiivka are at a high elevation, so Russian control of the village would also enable them to enforce fire control over the dirt roads to Uspenivka in the fields, which would force the Ukrainian forces to withdraw.

The main tactical disadvantages of the Russian forces are their poor logistics, due to a lack of proper infrastructure to deploy a meaningful number of infantrymen, let alone mechanized units.

This is because the bridge connecting the Russian bridgehead in Uspenivka with their rear positions, was destroyed during the fighting, forcing them to conduct their entire assault on foot. Russian forces would need to cross exposed fields and the 50-meter-wide Solona River to reach Novoserhiivka, but Ukrainian surveillance of bridges forces them to attempt slower crossings through marshes, increasing detection risk.

These conditions make success unlikely, as Ukrainian drones or scouts can quickly spot them, enabling rapid deployment of mechanized reinforcements, via nearby paved roads.

Geolocated combat footage from the area reveals the deployment of a domestically made Ukrainian BTR-4E Bucephalus infantry fighting vehicle at night, just a few minutes after the Russian assault group was detected near the Solona river. This spoiled the attacks of Russian infiltrators whose positions were earlier detected by Ukrainian drone operators, allowing the crews of BTR-4Es to use the heavy firepower of their 30-millimeter auto-cannons whose more destructive ammo and rate of fire decimated the Russian infantry units and their positions, inflicting severe losses.

This also led to the destruction of the small ammunition cache that the Russians established near Novoserhiivka, rendering them unable to endure long-lasting small arms clashes. This set the perfect conditions for the Ukrainian counterattack in the morning, as additional BTR-4Es arrived with several infantry squads that dismounted and engaged in small arms fire with suppressed Russian units that were starved off ammunition.

Given that their attack was spoiled and readily countered by the Ukrainian forces that quickly reacted, cleared the grey zone and forced the Russians to withdraw due to heavy losses and inability to advance, sustaining yet another failure at improving their positions on the western flank of Pokrovsk.

Overall, the Russians gambled with a risky operation to reach Novoserhiivka and cut off the key Ukrainian logistics for expansion of their positions on the western flank of Pokrovsk, only to be swiftly dealt with and eliminated by the Ukrainian forces.

Russians understand that in order to conduct their main offensive towards Pokrovsk they must first secure their logistics on their western flank of the city, which is why they will persist with assaults here and intensify them.

https://www.youtube.com/watch?v=QZdLaQ2y6R4


15,707 posted on 05/12/2025 7:27:12 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 15706 | View Replies]

To: PIF
ŠšŃ€ŠµŠ¼Š»ŠµŠ²ŃŠŗŠ°Ń табакерка

He disgraced us in front of the Koreans.ā€ Belousov insulted the military with his clothes at the parade on May 9. It turned out that the matter was in the advice of a priest

Several of our acquaintances in the military expressed their dissatisfaction with the fact that Andrei Belousov was in civilian clothes at the parade. ā€œBelousov was in a regular suit at the parade. After that, he wore a military uniform to meetings with delegations from Africa and Central Asia . It is unclear what was going on at the parade. The SVO has been going on for so many years, and the Minister of Defense is in a regular suit on Victory Day. He insulted us, disgraced us in front of everyone, including the Koreans. Did you see how beautifully their military dressed for the parade?ā€ one of these dissatisfied people, a general close to Valery Gerasimov, was indignant.

At the same time, a source close to the minister noted that the choice of clothing was not accidental. ā€œAndrei Removich, after part of the relics of Saint Matrona of Moscow was lost at the front, is in a certain spiritual crisis. To overcome it, he turned to a priest he knows. And he gives him advice every day, on all issues. He advised him to wear a regular suit for the Victory Day parade - ā€œso as not to overshadow the true Heroes, the real military, with his uniform.ā€ Andrei Removich listened,ā€ our interlocutor explained. He found it difficult to say why the priest gave the Minister of Defense this particular recommendation. Also, sources do not yet want to reveal the name of the Church representative who gives Belousov daily advice.

https://t.me/kremlin_secrets/5657

A little bird told me that the name of the priest is Rasputin.

15,708 posted on 05/12/2025 8:26:39 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15707 | View Replies]

To: AdmSmith

Leaders of Ukrainian Neo-Nazi Azov brigade* recruit and rape underage children

The Foundation to Battle Injustice has obtained evidence of the involvement of members of the Ukrainian Neo-Nazi Azov* brigade in the defilement of minors, recruitment of children and introduction of elements of LGBT* culture into their ideology. Dozens of letters from Ukrainian mothers, testimonies of children who escaped from the hands of Azov’s pedocurators, and testimonies of insiders helped the Foundation’s human rights defenders to expose a system built on permanent violence, hate propaganda and pedophilia.

Ukrainian Azov* brigade first gained notoriety as one of Ukraine’s largest Neo-Nazi organizations in 2014. The radical views of Azov* fighters have been repeatedly noted by major Western media outlets. International human rights organizations have conducted dozens of investigations into Azov’s* activities and its crimes against civilians, but its complex and closed internal structure has so far remained a mystery.

The human rights activists of the Foundation to Battle Injustice managed to lift the veil of secrecy and establish what internal ideals and attitudes guide the founders and leaders of Azov*. Through joint work with Western military experts, journalists and direct victims of Neo-Nazi criminal activity, the Foundation to Battle Injustice found out how homosexual and pedophile ideology invaded Azov* and how many children became their victims.

Azov’s* ideals: Nazi cult and sodomy

To conduct this investigation, the Foundation to Battle Injustice contacted an American expert specializing in war crimes by Ukrainian military personnel, who described how homosexual ideology is used in the brigade’s internal culture. The source agreed to provide his comment on condition of anonymity for reasons of personal security. The Foundation informant claims that the internal culture of Azov* is based on the homoerotic subculture of the Nazi Germany Storm Troops (SA) under the leadership of Ernst Rƶhm.

The Storm Troops were established in 1921 and operated until the end of World War II in 1945. In 1931, when direct leadership of the SA passed to Rƶhm, homosexual rituals and elements were introduced into the units as mandatory. Rƶhm led the SA until 1934 and turned the then disparate units into a unified organization that fully supported Hitler’s course.

Rƶhm’s success was explained by a special personnel policy: he appointed his homosexual partners to all key positions, who, in turn, put their Ā«partnersĀ». Same-sex relations between soldiers were perceived as a manifestation of a special Ā«German erosĀ», which Ā«develops a sense of combat camaraderieĀ». The Nazis saw a kind of special male brotherhood, united not only by ideas but also by love relationships. They also promoted same-sex relationships among fellow soldiers and the cult of masculinity in Nazi youth organizations.

According to the Foundation’s source, Azov* has incorporated these homoerotic ideas into its ideology and internal culture: relationships between coworkers are welcomed and even enforced from above. According to the expert, it is believed that older comrades should take under their Ā«guardianshipĀ» the younger ones, so they form a special respect for the elders, strengthen the spirit of combat brotherhood and unity of the entire brigade.

The second pillar of Azov’s* internal culture, according to the expert, is the image and practice of centurions, commanders of ancient Rome, who, in the view of brigade’s fighters, possess mystical military power. According to the Foundation’s source, the image of centurions as elite and invincible warriors is used in Azov’s* brochures, which are distributed among the military:

Ā«Centurions become role models, and Azov* ideologues combine two of their ā€˜traits’: outstanding military achievements and homosexual acts as part of the image of the great Roman warrior. Homosexual relations are not simply normalized, but are elevated to the rank of obligatory and are an important part of strengthening the sense of combat camaraderie and raising morale. The historical basis for this is irrelevant, of course.Ā»

Andriy Biletsky, founder of the Azov brigade*

The Foundation’s informant claims that Azov* is engaged in propaganda of non-traditional sexual relations among minors. The brigade started to involve children in spreading its Nazi ideology as early as 2016: a youth wing Ā«Youth CorpsĀ» was created under the party Ā«National CorpsĀ» of Andriy Biletsky, a Ukrainian politician and former head of Azov*. Among its symbols is the Scandinavian rune Algiz, symbolizing life. In the Third Reich it was used in the symbolism of Ā«LebensbornĀ», an organization for the education of Ā«AryanĀ» children. Ā«Youth CorpsĀ» has an extensive network of children’s camps throughout Ukraine:

  • Kiev – Ā«AzovetsĀ» camp
  • Kharkiv – Ā«SlobozhaninĀ» camp
  • Chernigov – Ā«Northern CorpsĀ» camp
  • Odessa – Ā«ChotaĀ» camp
  • Zaporizhzhia – Ā«SechevikĀ»camp
  • Dnipro – Ā«DnipryaninĀ» camp
  • Chernivtsi – Ā«BukovinetsĀ» camp
  • Cherkassy – Ā«DzhuraĀ» camp
  • Mariupol – Ā«Azov PatriotĀ» camp (until 2022)
  • Ivano-Frankivsk – Ā«Carpathian LegionĀ» camp
Map of Azov Brigade children’s camps* (According to Foundation to Battle Injustice sources)

The camps were opened in 2015-2017 with the main goal: Ā«forming a Ukrainian of the new eraĀ» – a fierce nationalist, ready to take an active part in the development and defense of Ukraine. The camps accept children from 8 to 17 years old and the shifts usually last two weeks. Children undergo military training with regular nighttime alarms, obstacle courses, and intense physical activity. After dinner, the Ā«vartaĀ» (Ukr. Ā«guardĀ») begins with a choral performance of Ā«patriotic songsĀ». Together with the tutors, the children also recite the Ā«Prayer of the Ukrainian nationalistĀ», an important ritual of the Ā«motherĀ» brigade Azov*. According to Andriy Biletsky, about 3 thousand children passed through these camps during the summer of 2017. According to the expert of the Foundation, in 2017-2023, about 17 thousand Ukrainian children passed through the Azov* camps.

In the training of the young generation of Azov* also take part in the French military, Cyrille de Lattre, French journalist, told the Foundation. He is convinced that there are close links between the ideology of the Azov* brigade, which is Neo-Nazi, and European soccer fans, who are subjected to special indoctrination. Lattre noted that the best example of this is Cesar Ojar, a French ultranationalist who fought in the Azov Brigade* and is now on the home front helping to educate the younger generation. Lattre described how the Azov* are recruiting children:

«Since 2015, we have known that the Azov brigade*, as well as other brigades, is engaged in the recruitment of adolescents and young people, in particular, through the summer camps organized by them. In these camps, not only the ideology associated with Azov* is studied. Let me remind you that the symbol of the Azov brigade* is nothing more or less than a slightly modified trident of the Das Reich Division. Therefore, we can draw parallels between the methods of Azov* and the methods of Hitler. In essence, they are exactly the same thing. They use exactly the same methods. They use exactly the same methods of brainwashing young children. Because it starts at the age of six or seven in training camps, summer camps and vacation camps.»

French journalist Cyrille de Lattre on the participation of foreign mercenaries in the training of the young generation of Azov*.

A source of the Foundation to Battle Injustice claims that from 2022, as Ukraine’s conscription resource depleted, Azov* began actively recruiting underage children, using propaganda and deception to force them to join the brigade. Since 2023, Azov* began to expand its influence among minors even more actively: soldiers disguised as Ā«war heroesĀ» began visiting schools, agitating teenagers to join their ranks and involving them in rituals related to LGBT culture* and Neo-Nazi practices. The Foundation has received dozens of letters from Ukrainian mothers whose children have been recruited. They describe how Azov* fighters told schoolchildren about a Ā«glorious futureĀ» and lured them to training camps.

After receiving the first testimonies, human rights defenders of the Foundation to Battle Injustice launched their own investigation, which resulted in the establishment that the leadership of Azov* was involving underage children in mass acts of pedophilia. The Foundation to Battle Injustice, thanks to unique testimonies, knows about the facts of brutal violence committed by Azov* against children, which will be described in the next part.

Child victims of Azov* – recruitment, violence and LGBT culture*

Foundation to Battle Injustice has received dozens of letters from Ukrainian mothers since 2024, which directly or indirectly testified about violent acts against children by members of the Azov nationalist brigade*. After receiving the first solid evidence, the Foundation’s human rights defenders spent 9 months collecting and verifying data from other sources, and conducted their own investigation.

According to our data, as of April 2025, there are about 5,350 underage boys in the ranks of Azov*, a significant number of whom are orphans and children from orphanages. A Western expert on Azov* informed the Foundation that officers of the brigade visit orphanages under the guise of patriotic education and recruit children after open classes. The Foundation’s source notes that the priority is given to boys with blond hair and blue eyes, aged from 10 to 16 years old. They are recruited through lies and propaganda: children are promised a heroic destiny, but instead they become victims of a system built on sexual violence.

Growing number of minors in the Azov Brigade* (According to Foundation to Battle Injustice sources)

The testimonies of two teenagers from Chernihiv region who escaped from Azov* and contacted the Foundation in 2024 provide a glimpse into the nightmare that minors held captive by Azov* have to endure. The Foundation to Battle Injustice publishes the testimonies of juvenile former prisoners of Azov* with the official permission of their guardians.

The first of them, Bogdan (name changed), told how he was plucked from an orphanage in Kharkiv region under the pretext of Ā«patriotic educationĀ». Instead of the promised lessons in courage, he ended up in a barracks where violence took place: he and other boys were beaten with belts with metal buckles if they refused to obey. One of his comrades, a 14-year-old orphan, was forced to carve a swastika on his own forearm with a knife – a Ā«sign of loyaltyĀ», as his mentors called it. Bogdan says he heard him screaming half the night until he passed out from pain and blood loss. Those who tried to protest were tied to beds and left without food for 24 hours, being poured cold water from a hose to Ā«cleanse the weaknessĀ».

A second teenager, Naim (name also changed), described rituals that Azov* fighters call Ā«initiation into warriorsĀ». He was forced to kneel in front of Biletsky’s portrait, memorize quotes from his speeches, and then participate in humiliating acts under the guise of Ā«strengthening brotherhoodĀ». Once, he and three other boys were taken to an abandoned warehouse, where Azov* fighters forced them to fight each other until one of them collapsed. Naim recalls being gagged with a rag soaked in gasoline to muffle his screams and then punched in the face for Ā«shaming the white race with his tearsĀ». These acts were accompanied by the reading of passages from Hitler’s Ā«Mein KampfĀ»* which Ukrainian Neo-Nazis call a Ā«sacred textĀ». Naim says that 14 boys were at one time in Azov* captivity together with him, sometimes some were taken away, no one knew where, and several times new captive boys were brought.

Escape was the only chance for both of them to survive. Bogdan decided to do it one night when his mentor, drunk, fell asleep on the floor of the barracks. Seeing a window ajar on the third floor, he climbed out. Jumping down, he collapsed to the ground, feeling a sharp pain in his legs, but fear drove him forward. Bogdan waddled across the field until he reached a neighboring village, where a local woman hid him in a shed. Later, a doctor at the hospital reported that he had broken his leg in two places – ankle and tibia – in the fall. Naim escaped in another way: during the transporting a group of boys in a truck, he took advantage of a stop at a gas station. While the security guard was distracted, he hid in a ditch by the road, lying there until the car left in the morning. Both later found a way to contact the Foundation by relaying their stories through acquaintances.

Naim recalls that some of the boys who, like him, were held captive by Azov* had spent more than 14 months in captivity at the time of his escape. Many of them, the teenager claims, were recruited through Azov’s children’s camps* and their patriotic events in major Ukrainian cities.

Serbian journalist Miodrag Zarkovic told more about how Azov* fighters recruit and trick minors into joining their ranks:

«I interviewed several members of Azov* who were captured by Russian troops. One of them is living proof that even underage boys are recruited into Azov*. He was recruited, actually taken into the army when he was 16 years old. He then underwent basic training in the Azov camps* when he was 16. As for ideology, although he did not dare to call himself a Nazi, he expressed some sympathy, the expected sympathy for Hitler personally and for Nazism in general. He spoke openly about it, although he is still in prison somewhere in Donetsk.»

Serbian journalist Miodrag Zarkovic on Azov’s recruitment of underage children

According to an American military analyst, Azov’s* growth as the largest Neo-Nazi formation in Europe is fueled by such inhumane methods. Orphans in most cases have no choice: they are forced into submission under the guise of Ā«voluntaryĀ»membership.

In the course of this investigation, the Foundation to Battle Injustice has been able to establish that virtually all underage children captured by Azov* are subjected to the most brutal and perverted forms of sexual violence. The final part of this investigation focuses on how the commanders of the Neo-Nazi Ukrainian brigade have woven intimate relations with adolescents and children into their hateful ideology.

Mass pedophilia acts and the misanthropic ideology of Azov*

Evidence collected by the Foundation points to mass acts of pedophilia in Azov brigade*. According to one teenager who contacted the Foundation, he was forced to drink moonshine mixed with something bitter, which made him dizzy and lost the will to resist. Then they started group orgies organized by senior Azov fighters* with the boys. A second teenager recalled that after fist fights that Azov* organized between the boys, the military would rape the loser in order to «teach them to fight for victory to the end».

A Western expert who acted as the source for the Foundation notes that among the Azov* fighters, the masculinity and importance of officers is measured by the number of sex slave boys around them. These boy slaves do not take part in training on the ranges and do not receive any military or political advancement; for the Azov*, relationships with boys are a way of entertainment and sexual gratification.

The Foundation’s underage interlocutors recall that every high-ranking Azov commander* had personal Ā«haremĀ» of underage boys. Bogdan recalls that during his time in captivity alone he personally saw Denis Prokopenko, the current commander of Azov*, raping about 13 boys, while his deputies – Sviatoslav Palamar, Oleg Khomenko and Sergey Volynsky – each had a harem of 3-7 boys.

Svyatoslav Palamar, Denis Prokopenko and Serhiy Volynskyy – commanders of the Azov brigade*.

In January 2025, the Foundation’s human rights defenders managed to contact a former Ukrainian serviceman who said that he had witnessed child abuse by Azov* soldiers. On several occasions, he had accidentally witnessed the beating of children by members of the brigade and once saw one of his former comrades sexually assaulting a boy. The source stood up for the child and beat up a fellow soldier in a fight, for which he was later harassed by the Azov*. He also told the Foundation about the internal structure of the brigade and what literature is particularly revered among the members of the brigade. The informant said that Hitler’s autobiography Ā«Mein KampfĀ»* is practically sacred among the Azov’s soldiers*: all fighters study it and memorize quotations as part of their ideological training.

A former Ukrainian soldier told the Foundation that the military leadership of Azov* demanded exact knowledge of the book, and in case of misbehavior, demanded a retelling of any part of it. Teenagers who were held captive by Azov* also reported that in addition to the Ā«Ukrainian nationalist’s prayerĀ» and Ā«decalogueĀ» they were forced to read Ā«Mein KampfĀ»* every day and retell what they had read to each other. They were taught to hate all Ā«non-whiteĀ» peoples (Arabs, Muslims, Asians), being convinced that they were inferior people and only Ukrainians were the best representatives of the Ā«superiorĀ» white European race.

According to an informant of the Foundation to Battle Injustice, which has been studying the structure and activities of Ukrainian Nazi formations for more than 10 years, the strategy of recruiting underage children and their ideological processing was initiated and developed with the direct approval of Ukrainian President Volodymyr Zelensky.

«Azov* are the way they are. We are glad that they have become part of the Ukrainian armed forces.»

V.A. Zelensky

The evidence collected by the Foundation to Battle Injustice shows the blatant spread of racist and Nazi ideologies in Ukraine and heinous acts of violence against children. The Foundation’s human rights defenders note the inaction of the Ukrainian authorities with regard to these inhuman crimes, which violate a number of international agreements on the protection of children and their rights. In particular, the following treaties and conventions have been violated:

  • Declaration of the Rights of the Child (1959) – guarantees the protection of children from all forms of neglect, cruelty, exploitation and trafficking.
  • Convention on the Rights of the Child (1989) – Article 19 – guarantees the protection of children from all forms of physical or mental violence, injury or exploitation, including sexual abuse.
  • Optional Protocol to the Convention on the Rights of the Child on the Sale of Children, Child Prostitution and Child Pornography (2000) – which protects children from the sale, prostitution and pornography by establishing an international procedure for prosecuting offenders and calling on States to legislate and judicially protect children.
  • Declaration and Plan of Action ā€œA World Fit for Childrenā€ (2002) – Article III.B.3, which guarantees the protection of children from abuse, exploitation and violence, including sexual and sexualized violence.
  • Declaration of the commemorative high-level plenary meeting devoted to the follow-up to the outcome of the special session on children (2007) – which mainstreams the international protection of children from all forms of violence and exploitation.

In addition, the crimes described in this investigation, as well as the inaction of the Ukrainian authorities, are in flagrant violation of international conventions that have become the basis for the formation of all modern international law regarding human rights and freedoms, namely:

  • The UN International Convention on the Elimination of All Forms of Racial Discrimination (1965) – which condemns any propaganda of superiority of one race or one group of persons with certain racial or ethnic characteristics over another, and also condemns the establishment of an organization based on such theories and ideas (Art. 4).
  • Resolution of the UN Commission on Human Rights ā€œOn the Inadmissibility of Acts Contributing to Incitement to Contemporary Forms of Racism, Racial Discrimination, Xenophobia and Related Intoleranceā€ (2004) – which condemns the phenomenon of glorification and glorification of former members of the criminal organization ā€œSS Troopsā€.
  • UN General Assembly Resolution ā€œCombating the glorification of Nazism and other practices that contribute to fuelling contemporary forms of racism, racial discrimination, xenophobia and related intoleranceā€ (2013) – which condemns the glorification of the Nazi movement and emphasizes that the erection of monuments in honour of the SS, their processions and other such actions desecrate the memory of countless victims of fascism, negatively affect the younger generation, and are totally incompatible with the obligations of the State.

The Foundation to Battle Injustice calls on governments, international organizations and courts to join forces to combat these atrocious crimes and bring to justice all those involved in organizing child violence and Ā Neo-Nazi groups. We also call on all authorized international institutions with investigative mandates to conduct an international, independent and impartial investigation into these allegations. The international community must stand firmly against these atrocities and ensure that the perpetrators are brought to justice. Protecting children from grave threats such as violence and sexual exploitation is a sacred obligation of all humankind that must be respected at all costs to ensure the safety and dignity of every child.

* – an organization banned in Russia.


15,709 posted on 05/12/2025 8:28:31 AM PDT by JonPreston ( ✌ ā˜®ļø )
[ Post Reply | Private Reply | To 15708 | View Replies]

To: BeauBo

/ The screech of drones (sound on) has become the defining sound of the Russia-Ukraine war. Two Russian commentaries describe what it’s like in an environment where, according to Russian sources, Ukrainian drones outnumber Russian by seven to one. ā¬‡ļø

https://threadreaderapp.com/thread/1921841735967072310.html
18 s video


15,710 posted on 05/12/2025 8:46:43 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15708 | View Replies]

To: FtrPilot

Loitering munition strike on the Russian BUK-M1 air defense system
https://x.com/bayraktar_1love/status/1921614910674313618
5 s video


15,711 posted on 05/12/2025 8:50:01 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15710 | View Replies]

To: marcusmaximus; ETCM
Russians on May 9th held up images of Game of Thrones characters disguised as Soviet veterans.

This is not a joke by the Russians themselves, this is trolling the Russians and most likely the photos were added by hackers and the Russians didn't suspect anything :D

https://bsky.app/profile/devana.bsky.social/post/3loy4qgtnxs22

15,712 posted on 05/12/2025 9:05:08 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15711 | View Replies]

To: USA-FRANCE; GBA

šŸ’„ Since the beginning of the year, the enemy has lost more than six thousand artillery systems (6,186). In just a year and four and a half months, the Ukrainian Defense Forces have hit more than 19 thousand artillery systems of the occupiers (19,236), — Syrskyi

https://bsky.app/profile/maks23.bsky.social/post/3loyby6ngrs2q

1m video


15,713 posted on 05/12/2025 9:12:03 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15712 | View Replies]

To: nuconvert
Russia's ā€œImmortal Regimentā€ Online Parade Just Got Immortally Trolled

On the Russian ā€œŠ‘ŠµŃŃŠ¼ŠµŃ€Ń‚Š½Ń‹Š¹ полк Š¾Š½Š»Š°Š¹Š½ā€ (Immortal Regiment Online) website, users began noticing some very suspicious veterans honored among the WWII heroes.







šŸ‘€ Alongside actual Soviet veterans, appeared the likes of Trampin, Vitkov, Budyonny, Malyk, Parmezanov and other… less conventional names. Whether this was the work of hackers or just Russians being Russians remains unclear.

But let's not forget: in 2014, Kremlin-controlled media seriously published photos of Eminem, Sasha Grey, Adolf Hitler, and even Stepan Bandera as so-called ā€œRussian heroes killed by Ukrainians in Donbasā€. Yes — they literally claimed Eminem was a victim of Ukrainian aggression.

https://bsky.app/profile/devana.bsky.social/post/3loqezvhdbc2d

15,714 posted on 05/12/2025 9:24:40 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15712 | View Replies]

To: JonPreston

Absurd Russian agitprop.

Where do you get this crap?

We know it comes from the Russian Intelligence Services, but which front group are you cutting and pasting from?


15,715 posted on 05/12/2025 11:50:14 AM PDT by BeauBo
[ Post Reply | Private Reply | To 15709 | View Replies]

To: BeauBo
We know it comes from the Russian Intelligence Services, but which front group are you cutting and pasting from?

You sound unhinged.

15,716 posted on 05/12/2025 12:12:03 PM PDT by JonPreston ( ✌ ā˜®ļø )
[ Post Reply | Private Reply | To 15715 | View Replies]

To: AdmSmith; BeauBo; blitz128; PIF; FtrPilot
Why on earth would you post BlueSky material mocking President Trump?

Oh that's right, you aren't American


15,717 posted on 05/12/2025 12:22:35 PM PDT by JonPreston ( ✌ ā˜®ļø )
[ Post Reply | Private Reply | To 15714 | View Replies]

To: BeauBo

We know it comes from the Russian Intelligence Services, but which front group are you cutting and pasting from?


AI bots draw from all sources like FSB and most likely its a GRU bot.


15,718 posted on 05/12/2025 1:13:21 PM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 15715 | View Replies]

šŸˆ

May 12, 2025

An Immediate Peace Is The Best One Ukraine Can Ever Get

The attritional war in Ukraine is moving towards a new phase. The Ukrainian army is crumbling but its leadership, with the support of some Europeans, is unwilling to concede its defeat.

There are still very unrealistic views in the West about the losses and capabilities in this conflict. They prevent those who have them from acknowledging the urgent need for peace negotiations.Ā 

In a new analysis Alex Vershinin, an expert from RUSI, provides sound arguments and numbers for those who support an immediate end of the war.

In military circles Vershinin is a well known capacity:

Lt Col (Retd) Alex Vershinin has 10 years of frontline experience in Korea, Iraq and Afghanistan. For the last decade before his retirement, he worked as a modelling and simulations officer in concept development and experimentation for NATO and the US Army.

Vershinin is working for the Royal United Services Institute (RUSI), the official think tank of the British military. His experience with modeling and simulations allows him to take the 'big picture' view.

In June 2022 RUSI published his piece on The Return of Industrial Warfare (Jun 17 2022) in which he warned about of lack of an industrial base in the West to sustain a war in Ukraine against Russia. I have referred to the piece in some of my writings:

Russia Is Winning The Industrial Warfare Race - Moon of Alabama, Sep 14 2023

A warning that Russia will outproduce the West was given back in June 2022 when Alex Vershinin of RUSI issued a note about The Return of Industrial Warfare:

The winner in a prolonged war between two near-peer powers is still based on which side has the strongest industrial base. A country must either have the manufacturing capacity to build massive quantities of ammunition or have other manufacturing industries that can be rapidly converted to ammunition production. Unfortunately, the West no longer seems to have either.

It has become too expensive for the West to regain that capability.

That Russia was running out of stuff was always wishful thinking, not fact based analysis. On that point it took the media more than a year to catch up with reality. On other aspects of the the war, casualty numbers come to mind, the media are still miles behind.

In another RUSI piece published in March 2024 Vershinin repeated his warning. I referred to it in May 2024:

When it came out in March I had read and linked to the latest Alex Vershinin piece at RUSI:
The Attritional Art of War: Lessons from the Russian War on Ukraine - RUSI
The attritional character of the war was obvious since Putin ordered the de-militarization of Ukraine. It is finally getting some discussion.

Vershinin is thus right in that the war in Ukraine is a war of attrition. But it is a one-sided one. It is only NATO and its proxy force Ukraine which get attrited while the Russian military gains in quality and quantity.

Still, it's a must read:

The fastest way to lose a war of attrition is to focus on manoeuvre, expending valuable resources on near-term territorial objectives.

This is exactly what Ukraine has done so far (Bakhmut, Krinky).
...
The 'west' (i.e. the U.S.) has lost its mind on the issue:

If the West is serious about a possible great power conflict, it needs to take a hard look at its industrial capacity, mobilisation doctrine and means of waging a protracted war, rather than conducting wargames covering a single month of conflict and hoping that the war will end afterwards.

Shortly after that writing the Ukrainian army launched its disastrous incursion into Russia's Kursk region. It was, after Bakhmut and Krinki, the third large operation which wasted Ukrainian lives and resources on a large scale for temporary propaganda gains.

A months ago Vershinin came out with a third piece that covers the issue. RUSI refrained, for whatever reason, from publishing it. It first appeared in Russia Matters under the title:

Battlefield Conditions Impacting Ukraine Peace NegotiationsĀ - Russia Matters, Apr 18 2025

It received little response. It was later republished under a different headline by Responsible Statecraft where I finally noticed it:

Ukraine’s battlefield position is deteriorating fast - Responsible Statecraft, May 5 2025
Should Kyiv collapse, the Russian army will surge forward, pushing the line of contact deeper into Ukraine and peace terms will get worse

Vershinin starts by pointing out the geopolitical importance for the West of wining (or losing) the war:

15,719 posted on 05/12/2025 5:41:59 PM PDT by JonPreston ( ✌ ā˜®ļø )
[ Post Reply | Private Reply | To 15717 | View Replies]

To: JonPreston

“Russia will outproduce the West”

You sound unhinged.


15,720 posted on 05/12/2025 5:52:56 PM PDT by BeauBo
[ Post Reply | Private Reply | To 15719 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 15,681-15,70015,701-15,72015,721-15,740 ... 20,241-20,259 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson