Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 15,541-15,56015,561-15,58015,581-15,600 ... 18,601-18,611 next last
To: BeauBo

Would be fitting if true, having the real man in charge of Russia, Xi, at the parade😎


15,561 posted on 05/08/2025 3:08:47 AM PDT by blitz128
[ Post Reply | Private Reply | To 15553 | View Replies]

To: blitz128
oops

Кремлевская табакерка
“Russian Community” (Русская община) found itself at the epicenter of a new scandal

Before they had time to sort out the resonant story in Vsevolozhsk, Leningrad Region, where a man died after a visit from activists of the “Russian Community”, representatives of the organization provoked a new scandal. This time, it was almost diplomatic.

On Wednesday, May 7, a dozen and a half activists decided to check the warehouse of one of the large marketplaces in the Moscow region for the presence of illegal migrants there. As it turned out, more than a hundred workers from North Korea were working in the warehouse. They did not have any documents with them, but the management of the enterprise had to urgently raise all connections to discourage the activists.

There are rumors that the head of the Investigative Committee Bastrykin, who is credited with patronage over the “Russian Community”, received a call from the Presidential Administration. And they gave a clear command to “take his guys under control.” Allegedly, such checks can affect relations with the DPRK (the personal consent of Kim Jong-un is required for workers from this country to arrive). Overall, it is interesting. Apparently, many people don't like the active methods of the “Russian Community”.

https://t.me/kremlin_secrets/5638

15,562 posted on 05/08/2025 4:18:51 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15560 | View Replies]

To: AdmSmith
Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

The complete transcript.

[ Ukrainian Bombs Rip Through Strategic Russian Base, Producing up to 9,000 Drones/Month! ]

Today [ Apr 25, 8 pm ], there are a lot of interesting updates from the Russian Federation. Here, flying deep behind enemy lines, Ukrainian long-range drones delivered a devastating blow to the only Russian Shahed production facility. Long-range drones loaded with 250 kilogram bombs tore through the final assembly line, throwing all Russian strike plans into disarray.

The Ukrainian strike happened at Yelabuga, located over 1,200 km away from the frontline. The Ukrainians used 6 drones for the strike on the main Shahed assembly facility, of which 5 Ukrainian drones managed to reach and directly strike their target despite Russian air defenses being present.

The strike led to severe damage to the final assembly line of the drone production facility, creating a bottleneck and disrupting the entire production process within the factory. This assembly is the most technologically complex segment, without which the rest of the drone production process cannot be completed. Targeting this facility hampers Russia’s ability to produce new Shaheds, thereby severely impacting its ability to continue its daily drone strikes on Ukraine.

For the strike, Ukrainians used small A-22 light training planes repurposed as drones to strike critical Russian military and economic infrastructure far beyond the frontline. These drones have a maximum flight range of over 1,500 km, with integrated GPS inertial guidance to conduct precision strikes. Each of these drones has an integrated payload of 250 kg, able to collapse the facility’s roof, already damaging production machinery, which was then followed by the next drone striking the factory floor itself, finishing the job.

The destruction of the assembly line at the Alabuga facility throws a massive wrench into Russian plans, as the Russians are exerting considerable effort to scale up production and increase the number of Shahed drone strikes. Since the launch of this factory, which produced 300 Shahed drones daily before the Ukrainians hit it, Russia has steadily increased the number of Shahed strikes each month.

Following the completion of the Alabuga drone production complex, the Russians continued to increase their production output, launching a massively increased number of Shahed drone strikes in the past 6 months. This number could have risen to 9,000 by the end of April, prompting the Ukrainians to urgently develop a plan to strike the Russian Shahed production facility.

The strike on the Alabuga plant was additionally prompted by the recent Russian development of an analogue to Ukraine’s Palianytsia jet-propelled drone. The upgraded Shahed, called the Geranium-3, features a turbojet engine for increased speed, raising from 200 kph to 600. This enhancement makes it much harder for Ukrainian mobile air defense units to intercept them, primarily relying on truck-mounted machine guns and autocannons to take down the Shaheds.

Western sources report that the Alabuga factory was a key producer of these new Russian jet-powered Shahed drones. With the new drones being significantly more difficult to intercept for conventional Ukrainian mobile air defense units, Ukraine would have had to rely on more expensive and very limited missile defense systems to protect its cities.

Destroying Russian production capabilities before these drones could be produced and implemented on a larger scale was a strategic play to prevent the Russians from exploiting weak spots in Ukrainian air defense, while the laser air defense is still in the early stages. This also shows that Ukrainians know the locations of these critical Russian factories, and can continue to target them, if they struggle to intercept the new Shaheds.

While Ukrainians have many potential targets to hit, they must choose wisely, due to the amount of time needed to plan and set conditions for such complex aerial operations, making it impossible to strike every location simultaneously.

Overall, the Ukrainians conducted a precision strike on the largest and most important Russian drone production facility, over a 1,000 km away from the frontline, causing massive damage to its production capabilities and greatly diminishing the number of drones available for further Russian strikes. The effects of the Ukrainian strike will be evident, with the planned Russian increase of Shahed strikes not becoming a reality.

Lastly, the strike demonstrates Ukraine’s constant awareness of potential Russian threats, making educated decisions on which facilities to hit with the most urgency, to achieve the most significant effect.

https://www.youtube.com/watch?v=-Tr9_gR1_6w

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

The complete transcript.

[ Russians Lost Air Superiority. Biggest Swedish Military Aid Package Changes The Game! ]

Today [ Apr 28, 8 pm ], there is an interesting update concerning the defense of Ukrainian skies. Here, the Ukrainian air defense got one of the biggest boosts as reports emerged that a new powerful flying radar from Sweden had probably already arrived in Ukraine. This system will help the Ukrainian air defenses not only in their offensive operations but will also significantly support their ability to defend the Ukrainian rear from constant Russian missile and drone attacks.

Sweden has pledged to deliver two ASC-890 airborne warning and control system planes to Ukraine as part of its largest military aid package to date, valued at approximately 1.16 billion euros. Sweden’s decision marks a significant enhancement in Ukraine’s air defense capabilities.

These aircraft, equipped with advanced Erieye radar systems, are designed to provide long-range surveillance and target identification. While official confirmation is pending, there are reports that a calibration aircraft was flying over western Ukraine, which might indicate Ukrainians are making final preparations, recalibrating and fine-tuning ground-based radars for the arrival of the new Swedish planes.

The ASC-890, based on the Saab 340 airframe, is an airborne early warning and control aircraft. It features the Erieye radar, a fixed, active electronically scanned array mounted atop the fuselage. This radar system offers a detection range of up to 450 km and can track multiple targets simultaneously, including aircraft, missiles, and drones.

By operating at high altitudes of 6,000 meters, the ASC-890 can monitor vast areas, providing real-time data to command centers and enhancing situational awareness. Essentially, aircraft like the ASC-890 serve as flying radar stations and command centers, coordinating air and ground operations effectively, with its compact size and reliability making it ideal for rapid deployment.

In the context of Ukraine’s current defense infrastructure, the ASC-890 represents a substantial upgrade. Ukraine’s existing radar systems are primarily ground-based, and even though some of them have a range of around 350 to 400 km, their immobility limits their range and makes them vulnerable to terrain obstructions. The ASC 890’s airborne platform overcomes these limitations, offering a broader and more flexible surveillance capability. This enhancement is crucial for the early detection of incoming threats, more accurate tracking of them, and a better response time that would allow Ukrainian air defense to intercept air threats more successfully.

The integration of the ASC-890 is particularly significant in light of Ukraine’s acquisition of Western fighter jets, notably the F-16s. After the manufacturer, SAAB, made some updates to improve the interoperability between the 2 systems, the ASC-890 can now provide these aircraft with comprehensive situational awareness, guiding them to targets and alerting them to potential threats.

As a result, these awacs will significantly improve the engagement range of the F-16s, allowing them to use their modern air-to-air missiles at their maximum ranges, as well as providing a significant improvement to the limited radar detection range of the F-16.

This synergy enhances the operational effectiveness of fighter jets, enabling more precise and coordinated missions. Additionally, the ASC-890’s data can even support Soviet-era Ukrainian fighter jets, extending their operational capabilities despite technological disparities. Sharing real-time radar data and threat information with ground-based command centers, Ukrainians can then relay targeting and situational awareness updates to the pilots via secure radio or datalink.

This allows older aircraft, despite lacking modern onboard radars, to operate more effectively by flying with external guidance and warning support.

15,563 posted on 05/08/2025 4:43:55 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15260 | View Replies]

To: BeauBo; PIF; LowIQ
Pray for Peace

We MUST BOMB Military Parade in Moscow.

We will.

Russian forces ruin Ukrainian homes and families daily under the guise of hunting "NATO mercenaries."

Can you name a single reason why Ukraine shouldn't strike these countless, legitimate military targets in Moscow?

It’s WAR. pic.twitter.com/GRgVM5p3d2— Dimko Zhluktenko 🇺🇦⚔️ (@dim0kq) May 7, 2025


15,564 posted on 05/08/2025 4:49:18 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15563 | View Replies]

To: JonPreston

Thanks for the updates


15,565 posted on 05/08/2025 5:31:48 AM PDT by blitz128
[ Post Reply | Private Reply | To 15563 | View Replies]

To: blitz128

Sit tight Low IQ, more coming throughout the day!


15,566 posted on 05/08/2025 5:39:21 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15565 | View Replies]

To: blitz128
(comments - *cussing alert)

Moon over Alabama, 5/8/25

May 08, 2025

Ukraine - Rada Blocks Detail Agreements Of Mineral Deal

The 'mineral deal' between the Trump administration and Ukraine continues to be a contentious issue.

The deal, which was signed last week, consists of (at least) three documents only one of which, the framework agreement, was made public:

The Ukrainian government claims that only the first part has been signed. The other two will follow only after the Ukrainian parliament, the Rada, has ratified the main one. Several 'western' media have contradicted that claim. All three parts of the agreement were signed. But the Ukrainian government is keeping the details of the second and third part secret because the conditions imposed by them are extremely bad for Ukraine.

As Strana reported (machine translation):

[T]he opposition already accuses the authorities of concealing the main points about the deal. The fact is that the agreement on the creation of the fund, signed last week and already made public, is being submitted for ratification, and there are very few specifics in it. This is essentially a framework agreement. For all the main points in the text of the agreement, there are references to another document - the Limited Partnership Agreement. There is also a third document - the Foundation's charter.

A number of deputies claim that all three documents have actually been signed (or agreed upon). But they showed only one-the least important and most abstract of them, from which it is not even clear what the Foundation will do in general.

The government denies this, saying that only one document has been signed, and the rest will still be discussed.

Ukraine's parliament, the Verkhovna Rada, is supposed to ratify the framework agreement today. It will likely do so but with a surprise.

Yesterday the Rada Committee for Foreign Policy passed the relevant language but added an amendment to it (machine translation):

"The Verkhovna Rada of Ukraine notes that the ratification of the agreement ... does not mean the ratification or automatic approval by the Parliament of the limited partnership agreement or any other agreements that will be concluded by the parties authorized to do so in order to implement this agreement.

The Verkhovna Rada of Ukraine declares that any additional agreements necessary for the implementation of the agreement ... cannot go beyond the provisions of this agreement and establish international legal obligations for Ukraine that are not provided for by it and are not agreed upon in accordance with the established procedure."

The additional text was supported by all members of the committee.

The two side agreements of the mineral deal, which the Zelesnki regime has signed and which include all the gory details of the deal, will be null and void without further ratification:

[I]f the resource agreement is ratified with this amendment, it will mean that either Volodymyr Zelensky will have to submit the limited partnership agreement to the Parliament for ratification, or there will be an opportunity to challenge the deal at any time and recognize it as worthless, since it was not fully ratified by the parliament.

If the ratification of the framework agreement takes place with the additional language the Trump administration may find that, for lack of detailed agreements, it has gained absolutely nothing from it.

It is not known if Zelenski had planned or even supported the parliament move. That all committee members, including those from his party, voted for the amendment may be a hint.

The question then is what Trump is going to do about it?

Posted by b on May 8, 2025 at 11:05 UTC | Permalink

Comments

HEY FUCKER .... you can hide down your dark hole but will still be exposed anyway

Posted by: S | May 8 2025 11:17 utc | 1

The question then is what Trump is going to do about it?

No. What are you going to so about it?

Nothing. Nothing at all.

The 'mineral deal' does not matter in the least. Probably why you're keep mentioning it Bernard. THat's all you ever do. Talk about nothing.

Posted by: S | May 8 2025 11:19 utc | 2

As expected.

Trump is likely breathing a sigh of relief right now.

Posted by: William Gruff | May 8 2025 11:26 utc | 3

The question then is what Trump is going to do about it?

Throw hands in the air, shrug and say, "I guess that's Ukraine for you ... you never seem to hear them say thank you for all we have done"

Trump is a lot of things, he plays games, he dances and manoeuvres ... but he ain't completely stupid. The same minerals have been sold to multiple buyers ... the minerals probably never existed in the first place ... and besides that the whole thing was primarily intended as a smoke screen to assist in the EU trousering Russian money.

Trump's purpose is blaming everyone else ... try to focus on that.

Posted by: Tel | May 8 2025 11:26 utc | 4

Maybe 10% for the big guy wasn't enough?

Posted by: jpc | May 8 2025 11:28 utc | 5

Thaks for the update. Clearly a story getting no coverage.
Curiously a non-elected president is being overruled by a non-elected Parliament - Democracy at Large!

The mineral deal is essentially a plan to employ a lot of Ukrainians (or immigrants with Israeli supervisors - which will be an interesting social experiment again) to dig holes for not a lot of profit. It will of course provide a lot of opportunities for Ukrainians and Americans to cooperate in their prime objective - corruption.

For the US the mineral deal is essentially a way for Trump to sell his massive climbdown to Russia. We give up Deveselu, the military camp in Romania and Redzikowo in Poland, and sign up to a bunch of missile agreements Trump and others tore up. But we get the mineral deal - So Trump, not Putin won in Ukraine Hurrah.

Posted by: Michael Droy | May 8 2025 11:34 utc | 6

Trump is likely breathing a sigh of relief right now.

Posted by: William Gruff | May 8 2025 11:26 utc | 3

Mmhmm. There are a lot of stupid people constantly insisting that President Trump is the most gullible man alive. But someone like that would never even have worthwhile real estate in New York.

Of course, the Ukrainians are mercenary criminals who think unilateral changes won't be remarked upon, especially in a foreign language. The American retort, of course, will be that they only acknowledge the deal written in English.

Posted by: They Call Me Mister | May 8 2025 11:39 utc | 7

I see the mineral deal what ever it is to be an excuse for failure to deliver on the campaign promise to stop the war in Ukraine in one day.
Words on paper.. structured to mean unenforceable..but arguably productive..

Posted by: snake | May 8 2025 11:39 utc | 8

They don't want to mortgage their future? Go figure. As long as the war continues, U.S. companies are not going into Ukraine unless they can hire cannon fodder

Posted by: Christian J Chuba | May 8 2025 11:41 utc | 9

And, with great fanfare (not), the entire charade collapses like the illusory fraud it always was.

Nothing more than a talking point for the Orangeman to claim "a big, beautiful deal-o!"

Posted by: Ghost of Zanon | May 8 2025 11:54 utc | 10

Spoils to the victor. Russia will take whole Ukraine, absorb Russian parts, the rest will most likely stand as independent country. All decisions by Zelenski and rada are considered illegitimate by both Ukranian constitution and Russia, so what ever is signed isn't worth paper it's signed on.

Cherry on top is that all the property already bought by blackrock and western entities in Ukraine will also get nationalized, as it should.

Posted by: Abe | May 8 2025 11:59 utc | 11

@William Gruff | May 8 2025 11:26 utc | 3

Trump is likely breathing a sigh of relief right now.
He can 'declare victory and leave' once more, but will he do it? Probably not.


Posted by: Norwegian | May 8 2025 12:04 utc | 12

I sold my neighbor’s car yesterday
Most of the minerals are now and forever under Russian control

Posted by: Anunnaki | May 8 2025 12:07 utc | 13

With the country's debt approaching 100% of GDP, Ukraine's Minister of Finance Serhiy Marchenko boasted about the possibility of shifting the burden of debt payments to European taxpayers.Most of this debt was borrowed during the war on soft terms from our partners. That is, we are talking about the fact that in the NEXT 30 YEARS we will not repay these debts," he said.The total amount of Ukraine’s state and state-guaranteed debt as of September 2024 was $155.69 billion, including the $112.06 billion of external debt, according to data released by the Ukrainian Ministry of Finance.


Soooo...DT without the minerals deal ratification that included a reduced element of debt repayment, and a clear message re loan repayment, the trickery of Ukraine is even more revealingnof its corrupt nature. Does that give DT anger, despair, a
sense of revenge, sufficient to stop all continuing armaments eg, declare Ukraine insolvent to be picked off by USA companies...any other leverage....and what about the other eebtees IMF ,especially UK as Alex Krainer forecast would be brought into finanncial crisis due to Ukraine debt tipping it over, EU banks and individual EU countries- so EU can suffer even more and DT can get "revenge"for EU stymying his plans and put down to a more subserviant level?

Posted by: Jo | May 8 2025 12:20 utc | 14

debtees lenders I mean not mispelt eebtes

Posted by: Jo | May 8 2025 12:23 utc | 15


Rarely mentioned are all the mineral rights sold to the Western oil majors after
Maidan, remember when they were going to frack the hell out of Ukraine as soon as
they got rid of the people.

Posted by: qparker | May 8 2025 12:25 utc | 16

[email protected] those predictions, or bets.....

Cheers M

Posted by: sean the leprechaun | May 8 2025 12:44 utc | 17


15,567 posted on 05/08/2025 5:50:36 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15565 | View Replies]

BOMB Military Parade in Moscow!!!

What is wrong with you people?

The Victory Day parade in Moscow is a legitimate military target.

"It's good that Putin is worried. Russia on a daily and nightly basis, for 3 years, has been murdering civilians with precision munitions."@CormacS63 pic.twitter.com/6xFxHEUeT2— Defence On The Brink (@DefenceBrink) May 4, 2025


15,568 posted on 05/08/2025 7:44:05 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15551 | View Replies]

To: JonPreston

Insults are always a good indication of high IQ, but keep them coming, appreciate it


15,569 posted on 05/08/2025 7:46:35 AM PDT by blitz128
[ Post Reply | Private Reply | To 15566 | View Replies]

To: BeauBo
9846897286738f3efd1471ca969c8105
15,570 posted on 05/08/2025 8:10:49 AM PDT by ANKE69 ( 🇺🇲 )
[ Post Reply | Private Reply | To 15554 | View Replies]

To: blitz128
🍈

Insults are always a good indication of high IQ, but keep them coming

kinda like calling me a Russian, living in Russia for the past three years?

That's on you, you own it.

but yeah, keep it coming

15,571 posted on 05/08/2025 9:36:22 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15569 | View Replies]

To: JonPreston

lol you were the one who said he was literally outside the burning wildberry warehouse, now certainly someone as “intelligent and high IQ” as yourself knows what literally means.


15,572 posted on 05/08/2025 10:14:24 AM PDT by blitz128
[ Post Reply | Private Reply | To 15571 | View Replies]

To: blitz128

If you actually believed that I lived “outside the burning wildberry warehouse”, you are not only dopey but also lack a sense of humor. When you dish it out be prepared to get it back in spades. at least from me. and please stop crying. I’ve only just begun, melon man 🍈


15,573 posted on 05/08/2025 10:27:45 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15572 | View Replies]

To: blitz128

Humm

https://freerepublic.com/focus/f-chat/4315750/posts


15,574 posted on 05/08/2025 10:27:54 AM PDT by blitz128
[ Post Reply | Private Reply | To 15572 | View Replies]

To: AdmSmith

“What can you guess the governors will do?”

Why falsify the data, of course - it is Russia.


15,575 posted on 05/08/2025 11:18:30 AM PDT by BeauBo
[ Post Reply | Private Reply | To 15558 | View Replies]

To: BeauBo

This was probably one of the most emotional scenes of the first Victory Day parades. Veterans of the Red Army, having just survived four years of war, dumped their war trophies; Nazi flags and swastikas; at the foot of Lenin’s Mausoleum, as if to say to each other, 'We did it, boys!'

pic.twitter.com/oEDE5o57Yd— WW2 The Eastern Front (@ShoahUkraine) May 8, 2025


15,576 posted on 05/08/2025 11:27:59 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15573 | View Replies]

To: JonPreston

May Day 1941, Wehrmacht soldiers were in Moscow celebrating with their Soviet allies.


15,577 posted on 05/08/2025 11:28:59 AM PDT by dfwgator (Endut! Hoch Hech!)
[ Post Reply | Private Reply | To 15576 | View Replies]

To: blitz128; JonPreston

It’s done:

“Ukrainian lawmakers voted Thursday to ratify a controversial economic partnership with the U.S. that gives America access to profit from the Eastern European country’s vast mineral resources.”


15,578 posted on 05/08/2025 11:33:16 AM PDT by BeauBo
[ Post Reply | Private Reply | To 15574 | View Replies]

To: BeauBo
It’s done

I support Donald Trump with his Peace effort.

15,579 posted on 05/08/2025 12:10:19 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15578 | View Replies]

To: dfwgator

how quickly that turned.


15,580 posted on 05/08/2025 12:11:05 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15577 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 15,541-15,56015,561-15,58015,581-15,600 ... 18,601-18,611 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson