Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 0putinsfolly; 0putinswar; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynow; anydaynowputinwins; anydaynowrussiawins; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; jonputinbot; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 15,441-15,46015,461-15,48015,481-15,500 ... 22,381-22,393 next last
To: FtrPilot

President Trump is serious about pressuring Putin for the 30 day ceasefire. US Navy ISR flight sent specifically to the Kerch Strait this morning. I’ve never seen anything like it throughout the entire war. Wild.


15,461 posted on 05/05/2025 6:08:49 AM PDT by marcusmaximus
[ Post Reply | Private Reply | To 15460 | View Replies]

To: marcusmaximus; All
MOSCOW HIT: Despite massive air defense, last night UKR drones attacked targets in the Moscow region. As Putin prepares for his ‘Victory’ event, concentrations of Ru combat vehicles and troops are staged throughout the city--- making it a target rich environment.

https://x.com/ChuckPfarrer/status/1919358517380538409

"...Despite massive air defense..."

The massive air defense is optimized against fast moving targets, such as cruise missiles and ballistic missiles.

Slow moving drones are a problem.

This is an important lesson learned from the war.

15,462 posted on 05/05/2025 6:09:11 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 15455 | View Replies]

To: marcusmaximus

US Navy ISR flight sent specifically to the Kerch Strait this morning. I’ve never seen anything like it throughout the entire war. Wild.


Could you elaborate for laymen?


15,463 posted on 05/05/2025 6:27:52 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 15461 | View Replies]

To: marcusmaximus
I wonder what "back channel" communications are being sent to putin.

"Nice bridge, if you can keep it."

15,464 posted on 05/05/2025 6:32:47 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 15461 | View Replies]

To: ANKE69

PIF, and his band of #NeverTrump war mongers, treat this tread as a means of weakening DJTs message of Peace & Prosperity. Thanks to you and some others, our voices won’t allow them to work, unimpeded, against America’s best interest and Donald Trump’s 11/5/24 electoral mandate.


15,465 posted on 05/05/2025 7:36:21 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15442 | View Replies]

To: FtrPilot

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

The complete transcript.

[ An Entire Russian Column Obliterated by an Explosion! ]

Today [ May 4, 8 pm ], there are a lot of interesting updates from the Pokrovsk direction. Here, in the open fields southeast of Pokrovsk, Russian forces are desperate to push Ukrainians back and salvage what little is left of their logistics.

However, as specialized Ukrainian equipment prevents Russians from even launching their assaults, Russian wrecks and bodies are quickly piling up, leading to another disaster for the Russian army.

The goal of the Russian forces is to advance north of their positions in Nadiivka across open fields to consolidate positions along the Solona River. This is because the Russian bridgehead on the western flank of Pokrovsk is too narrow, allowing the Ukrainians to constantly strike their logistics and forcing them to cancel their operational goals.

By advancing to the Solona river and expanding their control here, the Russians hope to facilitate a larger crossing and a wider pincer maneuver, hoping this will ease their logistical challenges, if they have less of a chokepoint for Ukrainians to target.

The 1st attempts to expand their control here, in the direction of Uspenivka, proved to be complete failures, as Russian corpses litter the approaches. So, Russians doubled down on their efforts from the south. Here, Russian supply lines are not as exposed and in a fire pocket as in the western pincer, meaning that Russians can employ armored vehicles without them being intercepted by Ukrainian drone and artillery fire along the way.

To counter this, the Ukrainian forces are employing remote mining techniques to scatter landmines in the fields between them and the Russians. The remote mining is conducted through the use of specialized artillery shells that open up to drop and scatter anti-personnel and anti-tank mines out over a specific area. Additionally, Ukrainians use heavy octocopter drones to carry and lay landmines on roads and chokepoints to further enhance and replenish the minefields.

Geolocated combat footage from the area reveals how the Russian armored units struggled to continue their attacks due to landmines. BMP infantry fighting vehicles, poorly armored against anything beyond small arms fire, were obliterated by landmines that detonated their internal ammunition, killing all aboard. Russian tanks, though more resilient, were eventually disabled by multiple mine blasts, forcing crews to abandon them, only for the tanks and the crew to be finished off by Ukrainian FPV drones.

After these assaults, the Ukrainians sought to prevent more Russian units from coming their way, knowing that they would eventually try to advance by overwhelming the Ukrainians with sheer numbers through heaps of destroyed metal and blood. To prevent the Russians from being able to even launch their assaults, Ukrainians decided to scatter landmines in the Russian rear to prevent them from initiating any new assault.

The Russians heavily rely on the town of Selydove for logistical support, where they station all of their tanks, armored vehicles, soldiers and ammunition. The Russian frontline positions are connected to it by one asphalt road, leaving it as the only route for their logistical support to deploy their forces. Unfortunately for Russians, this made it the best place for the Ukrainians to scatter their landmines to prevent Russians from launching their assaults.

Geolocated footage from the area reveals how Ukrainians mined the entire road, as one of the Russian vehicles moving to Nadiivka was completely obliterated by the landmine explosion. The footage shows how the landmines destroyed up to 6 other wrecks lay which were scattered around the same crossing, indicating that Ukrainians are constantly replenishing these minefields after Russians cleared them one way or another.

When still trying to conduct larger assaults, Russians moved in with platoon-sized formations of 3 vehicles closely grouped together. However, these formations consistently drove onto landmines, one after another, which led to the destruction of the entire assault formations. Additionally, the Russians deployed many of their infantrymen in unarmored vehicles, resulting in the deaths of entire infantry squads from a single landmine.

Overall, the Russians changed their operational plans on the western flank of Pokrovsk, forcing them to try and assault the Ukrainian positions further to the southwest, trying to salvage their logistics lines.

However, the constant Ukrainian remote mining operations are posing a major obstacle to these offensive plans as well, disrupting Russian assaults, dealing high losses, and often preventing them from launching outright. With whole minefields suddenly appearing on previously cleared roads, Russian efforts here have been stumped, as soon this area will be impassible for Russian armored vehicles as well.

https://www.youtube.com/watch?v=DtAUI8yUnC4


15,466 posted on 05/05/2025 7:44:20 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 15464 | View Replies]

To: JonPreston
Moon over Alabama, comments of 5/5/24

DPA/Wyatt frontline changes report: https://www.youtube.com/watch?v=Kqhl_UcqXXM

Note that at the end, he does a compilation of speed of advance and shows ~20 kmsq over two days or about 10/day.

To his credit, he does normalize by number of days (have seen him miss this before). However, the bulk of his reports are UFA or geolocation confirmations of previous RFA advances. The problem here is he is double counting. He counts it when it is an RFA claim. And then later counts it when confirmed. He tries to excuse this as "entertainment" and "two maps", but it's extremely poor analysis. I'm fine with EITHER MAP (optimistic or pessimistic) being used to track RFA advance. But you should not use both at same time. You are double counting.

And no, it's not just entertainment. I don't expect perfection. But at least common sense. Don't double count! Pick ONE MAP and use that as the reference.

Oh...and turn off the WhatsApp notification alarm. And get off my lawn.

Posted by: Anonymous | May 4 2025 14:52 utc | 1

Thank you b, for the Jonathan Cooke article on the Guardian's drip-drip-drip of news about atrocities committed by Israel posted in the Week in Review. There is also a video from the Duran posted in this week's lineup featuring John Meirsheimer and Glenn Diesen which demonstrates an equally culpable change of narration that distorts the argument regarding Ukraine, being presented as an unsolvable war no matter the result. Given that body's usual careful accuracy on this subject, I found this change extremely disturbing. So I shall present again, in my next post, that link.

The two conflicts seem to be joined at the hip in such deviations from accurate reporting. We have become accustomed to having to come online to find journalism we can rely on, but lately the field has been increasingly under attack. We can't do a lot as mere observers but at least we can point out distortions as they occur.

And Mark2 at 1, please refrain from such attacks. We have no authority here; it is b's blog.

Posted by: juliania | May 4 2025 15:17 utc | 2

Here is the video I referenced in my comment 3 above. I would be happy to have others' opinion of it. I realize there are plenty of excellent observations by the participants which I have not referenced, but to my mind those only make the dispiriting equalization of the sides in the conflict more than just a polite reference point. It may have been a personal opinion but it ought to have been contested. That is my feeling. I'm happy to have others disagree, as many did in the comments to the video.

Posted by: juliania | May 4 2025 15:28 utc | 3

Here is the video I referenced in my comment 3 above. I would be happy to have others' opinion of it. I realize there are plenty of excellent observations by the participants which I have not referenced, but to my mind those only make the dispiriting equalization of the sides in the conflict more than just a polite reference point. It may have been a personal opinion but it ought to have been contested. That is my feeling. I'm happy to have others disagree, as many did in the comments to the video.

Posted by: juliania | May 4 2025 15:28 utc | 4

Woops, that went before I was ready.

https://www.youtube.com/watch?v=Dy60zHLlNGU&t=3745s

Posted by: juliania | May 4 2025 15:30 utc | 5

Woops, that went before I was ready.

https://www.youtube.com/watch?v=Dy60zHLlNGU&t=3745s

Posted by: juliania | May 4 2025 15:32 utc | 6

Ukraine and World Affairs: Weekly Update, 2nd May 2025: May be useful to some: https://robcampbell.substack.com/p/ukraine-and-world-affairs-weekly-f3b

Posted by: The Busker | May 4 2025 15:50 utc | 7

The Duran.

Russian military objectives w/ Stanislav Krapivnik

https://www.youtube.com/watch?v=sUCjIWgHs4w

Posted by: unimperator | May 4 2025 15:53 utc | 8

Almost 1.500 day

all maps show bridgehead SW of a yantarne

all maps show breach of pokrovsk main circle defense

all maps show multi-pronged drive north towards konstantinivka

all except DS :D

Posted by: Newbie | May 4 2025 16:00 utc | 9

Here is the video I referenced in my comment 3 above. I would be happy to have others' opinion of it. I realize there are plenty of excellent observations by the participants which I have not referenced, but to my mind those only make the dispiriting equalization of the sides in the conflict more than just a polite reference point. It may have been a personal opinion but it ought to have been contested. That is my feeling. I'm happy to have others disagree, as many did in the comments to the video.

Posted by: juliania | May 4 2025 15:28 utc | 4

I agree with you,Juliana!

Posted by: Northern Eve | May 4 2025 16:11 utc | 10

Some takes:

-RUAF Will encircle Kharkov
-Slavyansk and Kramatorsk are cut off from Kharkov when Lyman falls
-From Lyman Slavyansk and Kramatorsk effectively isolated, and also straight shot up toward Kharkov
-AFU complains RUAF not playing 'fair' by not attacking cities head-on, but encircling
-AFU facing two front war along Dniepr in the south and the East, with limited logistics over two bridges and Kharkov route under threat
-Kharkov electricity fragile, causing most people to leave and less human shields for AFU
-Chasov Yar was the last major fort area in the central front, the ones west of it are a speed bump relatively
-Kherson will have to be dealt (probably after other advances have taken place)

Posted by: unimperator | May 4 2025 16:13 utc | 11

Posted by: Newbie | May 4 2025 16:00 utc | 10

Does anyone else try to sell UAF beautiful retreat over RAF poor advance?

Posted by: Rutte | May 4 2025 16:14 utc | 12

This thread is looking a bit like a failure to launch scenario.

To really get it moving, I will impart a little thought candy for those with some time to chew...

Putin is NOT looking like he's impotent and out of options no matter what the one article in the weekly review seems to imply, far from it. Putin is working from a plan laid out a few years earlier so there will be no surprises for the Kremlin and Russian General Staff to worry over no matter what comes down the pike.

**Russia has already agreed along with China to a total transition of power from West to East and this is good news for Asia, Africa and the Global South but there WILL be a few bumps in the road to get there. Russia with 10,000 tons of gold and China, with 20,000 tons are all set to backstop a somewhat less than cordial hand-off of power by the all powerful bankster cabal. There will be a few eggs cracked to get to this Big, Beautiful transfer of wealth but in the end, Putin, XI and a few others will step up to take the place of the politicos front-running the decline of the Western Financial System. Things are going slowly right now, but soon the regional wars that could be building in the ME and with these EU puppies will take us to the next phase of this transition.

Forget the popcorn, you need supplies, food and water, and real money. Become independent quickly..

Posted by: bisfugged | May 4 2025 16:19 utc | 13

-Of RUAF 1.5 million (growing) army 600k involved in Ukraine, rotations happen for experience gain
-RHeinmetall built 8 tanks and NATO 40 tanks vs. Russia built 400 last year
-US sucking money out of EU since EU can't arm Ukraine itself
-EU fully committed in Ukraine
-Potential French/UK contingent trying to run toward Odessa would come under attack

Posted by: unimperator | May 4 2025 16:22 utc | 14

Christoforou is going to have to 'up' his cat treats game by opening the cellophane bag of treats *before* he begins his walk 'n talk video.

That way, when he encounters one of the Cats of Limassol, he won't have to set his videocam down, its lens trained, close-up, on a pile of gravel for 30 seconds, while he struggles to open the cellophane bag.

Plus--one of the cats walked away, uninterested, when Christoforou took *forever* in readying the treats.

Plenty of distractions when addressing geopolitical events relative to the SMO lately. Nothing against cats, especially urban strays, but it seems ever since DJT phoned VVP that first week of February the commentary from our faves has taken a nosedive.

It's as if it is difficult for our faves to reboot the plot-line when they give commentary on Project Ukraine these days. It's like when Season One of a streaming-series ends and the scriptwriters sit around, unable to figure out what to do for Season Two.

Something in DJT's stepping in after retaking the White House has put some English on the narrative thread. DJT spent three months negotiating and then misdirecting and then gnashing his teeth about "all the killing" and then ultimately affirming the U.S.'s support for Ukraine.

But it is as if an aspect of the past 3 months, related to DJT's style of diplomacy, has sucked all the air out of the room.

Posted by: steel_porcupine | May 4 2025 16:37 utc | 15

Rt reports “Putin said;”

https://www.rt.com/russia/616711-putin-collective-west-conflict/

May, 2025 15:54
HomeRussia & FSU
Russia standing alone against West – Putin

Excerpts only:

“Russia is essentially standing alone against the collective West. This required a serious attitude to the possible development of the situation in this particular sense,” Putin stated.”

“Russia is standing alone against the West, which is waging an “existential war” against the country, President Vladimir Putin has said”

Give it up Putin, your poor “put upon” Nation, …all “alone”.
As if Iran, Cuba, Venezuela, Myanmar, North Korea haven’t been “standing alone” against the collective West for 40 years or more.

Your stupid lil 2-3 year spat, whereby all these nations, including China & So. Africa have been, in fact, aiding and supporting your dumb ass.

For an otherwise excellent Statesman and Leader of Russia, these “Trump-like” statements reflect he is spending way too much time of late talking with Trump. Poor “victimized” Russia.

Posted by: Trubind1 | May 4 2025 16:42 utc | 16

Posted by: Trubind1 | May 4 2025 16:42 utc | 17

##########

Friend, worry less about what people say, and more about what they do.

All talk is cheap.

Posted by: LoveDonbass | May 4 2025 16:47 utc | 17

Can someone please explain what 3LA is? I tried a search engine, but it was unhelpful.

And big thanks to Rob Campbell for his weekly round-ups of the news. That I find helpful.

Posted by: wagelaborer | May 4 2025 16:50 utc | 18

Can someone please explain what 3LA is? I tried a search engine, but it was unhelpful.

And big thanks to Rob Campbell for his weekly round-ups of the news. That I find helpful.

Posted by: wagelaborer | May 4 2025 16:50 utc | 19

https://t.me/CyberspecNews/80275

Kyiv struck earlier this evening...Secondary explosions occuring.

Posted by: donten | May 4 2025 16:52 utc | 20

Posted by: wagelaborer | May 4 2025 16:50 utc | 20


3 Letter Agencies

Posted by: Mary | May 4 2025 16:58 utc | 21

RE: All talk is cheap.

Posted by: LoveDonbass | May 4 2025 16:47 utc | 18

True.

Just wish this whole last 50 years of “victum” card worship would end.

Even further, it is rather publicly disrespectful to those that have, both publicly & privately “stood” alongside of Russia. Like Belarus even.

Posted by: Trubind1 | May 4 2025 16:58 utc | 22

UKR sources report situation is bad in the area of Konstantinovka, where RUAF Drones control all movement. Combined with earlier reports AFU counter-attacks coming out of Konstantinovka toward the southern RUAF advance were repelled, we might see RUAF getting a firm grip in south outskirts of Konstantinovka soon.

Posted by: unimperator | May 4 2025 17:03 utc | 23

Posted by: juliania | May 4 2025 15:17 utc | 3
Posted by: Northern Eve | May 4 2025 16:11 utc | 11
RE: interrogating the Duran Channel's vid w/ Diesen, Mercouris & Mearsheimer
<<


I sense a measure, among our faves, of grasping about, attempting to find a unique way to drill down into the SMO and, more broadly, Project Ukraine that will lend insight to the doings, but some element---is it energy? is it spirited illumination?---is no longer operative as it was, say, 8 months ago.

It's as if all the secrets & surprises have drained away by now.

Something in DJT's appearance on the scene has kicked the stuffing out of Project Ukraine.

My thought is that the false promises of DJT's desire quickly to end the war took our fave commentators & *us* to a summit of expectation. All that has gone kaput by now, and we're left w/ the ordinariness of the SMO, the routine of Project Ukraine, without anything having refreshed them.

I think this is a passing phenomenon, something transitory, however. Our faves will get their mojo back and be able to pivot.

I'm listening to the gents interview Stanislav Krapivnik right now about the LOC, and all three guys are delivering bigly.

Posted by: steel_porcupine | May 4 2025 17:05 utc | 24

Posted by: juliania | May 4 2025 15:17 utc | 3
Posted by: Northern Eve | May 4 2025 16:11 utc | 11
Posted by: steel_porcupine | May 4 2025 16:37 utc | 16
RE: interrogating the Duran Channel's vid w/ Diesen, Mercouris & Mearsheimer
<<

DJT has destroyed the ability of The Duran to produce compelling content-!

/s

Posted by: steel_porcupine | May 4 2025 17:28 utc | 25


15,467 posted on 05/05/2025 8:18:56 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15465 | View Replies]

To: PIF
Partisans of the "ATESH" movement set fire to a transformer substation in Saratov, Russia.

Now Putin's army faces logistical and communication issues. Power supply was completely disrupted at two base stations that served key industrial sites, including the GazPromMash oil refinery, Pirogroup factory, and a mobilization center used for coordination.

https://x.com/wartranslated/status/1919389079000563941


15,468 posted on 05/05/2025 8:41:10 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 15466 | View Replies]

To: FtrPilot
Trump just posted on Truth that he spoke with Erdogan about various issues, including Gaza, Syria and Ukraine. The closing line of the post was (IMHO) meant for Putin, after Russia refused to work with him.

"In any event, I look forward to working with President Erdoğan on getting the ridiculous, but deadly, War between Russia and Ukraine ended — NOW!"

Erdogan has played both sides of the conflict from the beginning. Trump has plenty of cards to play with Erdogan if he chooses. One of the biggest deals Trump could make would be to finally get the Qatar-Turkey pipeline deal done, since Russia/Assad were the primary barrier. Putin would give almost anything to stop that.

15,469 posted on 05/05/2025 10:42:55 AM PDT by ETCM (“There is no security, no safety, in the appeasement of evil.” — Ronald Reagan)
[ Post Reply | Private Reply | To 15468 | View Replies]

To: ETCM; BeauBo; BroJoeK; AdmSmith; PIF; FtrPilot; blitz128; marcusmaximus

A few years ago I read that members of Trump’s family were dealing with Erdogan’s sons-in-law regarding a possible big hotel deal. I have also read that Zelensky and Erdogan have talked several times about the Crimea situation, possibly with agreement that Crimea would stay with Ukraine. Ukraine controls an important source of water for Crimea. Definitely a plus that Russia has lost power in Syria.


15,470 posted on 05/05/2025 11:11:26 AM PDT by gleeaikin (Question Authority: report facts, and post their links)
[ Post Reply | Private Reply | To 15469 | View Replies]

To: gleeaikin

Ukraine controls an important source of water for Crimea.


Not any longer. The valve station is now in Russian controlled territory. Without that valve being open, the norther part of Crimea would revert to semiarid desert.


15,471 posted on 05/05/2025 12:57:15 PM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 15470 | View Replies]

To: FtrPilot; All

Lots of explosions near Moscow right now.


15,472 posted on 05/05/2025 4:34:42 PM PDT by marcusmaximus
[ Post Reply | Private Reply | To 15468 | View Replies]

To: marcusmaximus

“Lots of explosions near Moscow right now.”

Second night in a row. All of Moscow’s four airports had to suspend operations, so you can imagine what a train wreck that was for air travellers. (Moscow is their main air hub for civilian aviation)

Maybe this is the start of a concerted air campaign, “The Battle of Moscow”.

Maybe this is probing and mapping the Air Defenses, in preparation for a big attack on “Victory Day”.


15,473 posted on 05/05/2025 8:23:33 PM PDT by BeauBo
[ Post Reply | Private Reply | To 15472 | View Replies]

To: gleeaikin; FtrPilot
Russian Offensive Campaign Assessment, May 4, 2025

Russian sources claimed on May 5 that Ukrainian forces conducted a series of limited attacks across the Russia-Ukraine international border near Tetkino, Kursk Oblast. Russian sources claimed on May 5 that Ukrainian forces attacked across the Russia-Ukraine international border near Tetkino and Popova-Lezhachi (far west of Sudzha and southwest of Glushkovo) and Novyi Put (east of Tetkino) on the evening of May 4 and morning of May 5.[1] Russian milbloggers claimed that Ukrainian forces used mine clearing equipment to create a path through Russian minefields along the border, but that Ukrainian forces have not made significant advances in the area thus far.[2] Russian milbloggers claimed that Ukrainian and Russian forces engaged in a small arms clash near the Tetkino Railway Station in southern Tetkino and that Ukrainian forces later withdrew back into Sumy Oblast.[3] A Russian source claimed that Ukrainian forces have not seized Tetkino or broken through Russia's defenses near Novyi Put.[4] Russian sources claimed that elements of the Russian 98th Airborne (VDV) Division, likely referring to the 5th Anti-Aircraft Missile Regiment, other Russian military personnel, and Russian border guards are defending against the Ukrainian attacks.[5]

Ukrainian forces are attempting to isolate Russian units near Tetkino and throughout Glushkovsky Raion. The Ukrainian General Staff reported on May 4 that Ukrainian forces struck a Russian reconnaissance and strike drone command post near Tetkino and killed up to 20 Russian servicemembers.[6] Ukrainian Center for Countering Disinformation Head Lieutenant Andriy Kovalenko stated that Russian forces have been training drone operators at a school in Tetkino since 2022.[7] Russian sources claimed that Ukrainian forces intensified drone strikes and artillery fire against Tetkino in the night of May 4 before attacking toward the settlement.[8] Russian milbloggers claimed that Ukrainian forces destroyed a bridge over the Seim River between Zvannoye (northwest of Glushkovo) and Tetkino.[9] Other Russian milbloggers claimed that Ukrainian forces are also using drones to interdict Russian logistics in the area.[10]

Ukrainian President Volodymyr Zelensky and Czech President Petr Pavel announced on May 4 that Czechia will work with Ukraine to establish a school to train Ukrainian pilots on F-16 fighter jets outside of Ukraine.[22] Pavel added that Czechia and members of the French- and British-led Coalition of the Willing will train Ukrainian pilots. The US Department of State announced on May 4 that it approved $310.5 million for F-16 training, equipment, and support services for Ukraine.[23] Zelensky stated that the Czech Ammunition Initiative could deliver 1.8 million artillery shells to Ukraine in 2025 and that Ukraine is expecting its allies to deliver three million artillery shells in total this year.[24] Czech Defense Minister Jana Černochová stated in April 2025 that the Czech initiative had secured funding for artillery deliveries to Ukraine through Fall 2025.[25]

A Russian milblogger claimed on May 5 that Ukrainian forces maintain a limited presence in northwestern Belgorod Oblast near Popovka and Demidovka (both northwest of Belgorod City).[26]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-may-5-2025

15,474 posted on 05/05/2025 11:39:51 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15457 | View Replies]

To: BeauBo; blitz128
Day 1,167 of the Russian invasion. 1,430 [average is 822/day], i.e. more than 59 Russians and Norks/h. Vehicles and fuel tanks more than 150% and artillery more than 155% above average. Motorcycles are not counted yet.


15,475 posted on 05/05/2025 11:56:07 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15458 | View Replies]

To: PIF
The number of mortgage loans in Russia has fallen to a record low

The mortgage crisis is gaining momentum: the market has bounced back from the January bottom, but has not risen high. In March, issuances increased by 13% compared to February, according to data from the Central Bank, and in just one quarter, Russians took out 142.7 thousand loans for 611 billion rubles. This is the minimum amount since 2018, when the regulator began publishing this data. Even after the start of the war, in the second quarter of 2022 there were more - 151.4 thousand. In money, the result of January-March is also one of the worst in history, despite the strong growth in real estate prices. The average mortgage loan in March was a record 4.4 million rubles - a third more than in the spring of 2022 and about twice as much as in 2019-2020.
https://t.me/ejdailyru/320901

Кремлевская табакерка
“Mortgages are in trouble.” Putin is asked to do something about loans and prices

The number of mortgages in Russia has fallen to a record low, colleagues report . We warned that this would happen back in October last year. Unfortunately, bad forecasts are coming true. “Mortgages are in trouble. Most Russians have lost the opportunity to take out a home loan. It is clear that the SVO has influenced the situation. But I believe that the main problem is the actions of the Central Bank. Mortgages have become unaffordable, no one sees any reduction in prices, although Nabiullina’s people are predicting a gradual improvement in the inflation situation. In all this, I see a threat of a serious social crisis with unpredictable consequences,” a high-ranking source in the Kremlin told us. He also reported that he had asked Vladimir Putin to “do something about loans and prices.” “I have asked and I ask again: we need to force Nabiullina to lower the key rate. She is resisting, as far as I know, and Vladimir Vladimirovich listens to her opinion. It seems to me that this is a dangerous path,” the channel's interlocutor believes.

A source in the Central Bank responded to these claims: “The low availability of mortgages in the current conditions is natural. We must be grateful that mortgages still exist in Russia at all. And that prices are growing as they are now, and not two or three times faster. As for the key rate, I am sure that Vladimir Vladimirovich will not interfere with the work of professionals.”

https://t.me/kremlin_secrets/5626

15,476 posted on 05/06/2025 12:17:44 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15059 | View Replies]

To: ETCM
Russia is not satisfied with the Ukrainian territories it has already seized during the war and seeks to take over the entire country, US President Donald Trump said in an interview with Meet the Press on NBC News.

When host Kristen Welker asked what Russia would have to give up as part of a peace agreement with Ukraine, Trump responded: “All of Ukraine.” Welker pressed Trump for clarification, asking if he meant that Russia would not retain a single piece of Ukrainian territory it has seized.

“No, no. Russia would have to give up all of Ukraine. Because what Russia wants is all of Ukraine. And if I didn't get involved, they would be fighting right now for all of Ukraine. Russia doesn't want the strip that they have now; Russia wants all of Ukraine,” Trump said. “And if it weren't me, they would keep going. Do you know that the European Union leaders have asked me to call Putin so many times? Because he doesn't return their phone call.”

https://united24media.com/latest-news/russia-wants-all-of-ukraine-not-just-occupied-territories-trump-says-8098

15,477 posted on 05/06/2025 12:27:08 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15469 | View Replies]

Muscovian losses

THE dashboard https://lookerstudio.google.com/reporting/dfbcec47-7b01-400e-ab21-de8eb98c8f3a/page/p_wdrgjv1iyc?s=oZn9Nn6xNWE

and how to use it https://freerepublic.com/focus/bloggers/4219673/posts?page=15187#15187

15,478 posted on 05/06/2025 12:43:51 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15187 | View Replies]

To: AdmSmith

“the Czech Ammunition Initiative could deliver 1.8 million artillery shells to Ukraine in 2025”

Wow, that alone would keep Ukraine firing about 5,000 rounds per day, which is more than they had available for long stretches of this war.

Czechia has really proven to be a great ally to Ukraine.


15,479 posted on 05/06/2025 2:43:03 AM PDT by BeauBo
[ Post Reply | Private Reply | To 15474 | View Replies]

To: AdmSmith; JonPreston

“asked what Russia would have to give up as part of a peace agreement with Ukraine, Trump responded: “All of Ukraine.””

Time for Jon Preston to get on the Trump Train, and stop his anti-Trump, anti-American agitation for Russian conquest.

Russia out of Ukraine is Trump’s position.

All of Ukraine.


15,480 posted on 05/06/2025 2:53:42 AM PDT by BeauBo
[ Post Reply | Private Reply | To 15477 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 15,441-15,46015,461-15,48015,481-15,500 ... 22,381-22,393 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson