Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 15,041-15,06015,061-15,08015,081-15,100 ... 19,861-19,877 next last
To: SpeedyInTexas; GBA
21NOV2025 Consumer loan rates in Russia hit 44% and repayment problems grow

As of the beginning of November, consumer loan rates in Russian banks ranged from 25% to 38% per annum, but by 19 November, the maximum rate had risen to 44%. It is noted that almost half of borrowers have problems with loan repayment: 35% have minor difficulties, 12% have serious ones, and 1% admit that they can no longer pay at all.

Background: The Central Bank of Russia has decided to raise its key policy rate by 2 percentage points at once - to a record 21% per annum.
https://www.pravda.com.ua/eng/news/2024/11/21/7485690/

26MAR2025 Experts and Researchers Discussed Trends, Risks, and Opportunities in Bank Lending
Alexander Danilov, Director of the Banking Regulation and Analytics Department at the Bank of Russia:
“At several banks, the concentration of credit risk per borrower has reached critically high levels. In the event of default, this poses a serious threat to their financial stability. “

Mikhail Matovnikov, Ph.D. in Economics, Senior Managing Director and Chief Analyst at Sberbank
“Currently, there are two potential bubbles: one in residential construction, and another in the mortgage market. While related, they are not identical. In China, we see entire buildings being demolished because no one is buying the units. At the same time, we face borrowers who are unable to repay their loans.”

Key Findings of the 14th Research Seminar
The impact of effective management on bank stability is nuanced: under normal conditions, it helps mitigate risks, but in the presence of high levels of non-performing loans, it may drive more aggressive lending strategies.

Heavy reliance on foreign currency borrowing increases crisis vulnerability. However, regulatory tools — such as taxation on foreign currency loans — can help mitigate these risks.

The subjective outlooks of bank executives significantly influence both credit loss provisioning and loan issuance volumes, especially during times of crisis.

https://icef.hse.ru/en/news/1032294160.html

15,061 posted on 04/21/2025 5:29:36 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15059 | View Replies]

To: AdmSmith

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

The complete transcript.

[ F-16s Wipe Out Massive Russian Columns on the Road! ]

Today [ Apr 20, 8 pm ], there are a lot of interesting updates from the Belgorod direction.

Here, Russians are deploying a massive amount of infantry to push Ukrainians out of their 2nd incursion across the Russian border, before new Ukrainian reinforcements can consolidate their positions. However, before Russians could get into position, Ukrainians used a devastating series of air strikes to wipe out Russian troop concentrations left and right, absolutely destroying the Russian response.

The goal of the Ukrainian forces in this area is to disperse the Russian focus away from their offensive in the Sumy region. To achieve this, Ukrainians aim to fight on a battlefield of their choosing, by deploying forces to strengthen their incursion in the Belgorod region. The main Ukrainian disadvantage in Sumy is that the Russians are concentrating the entirety of their former Kursk contingent in one place, which consists of approximately 62,000 soldiers, with only half of the previously active frontline length.

By expanding the fighting into more favorable terrain in Belgorod, Ukrainian forces can stretch Russian lines and gain a tactical edge. Unlike northern Sumy, Belgorod offers a larger network of minor roads, complicating Russian efforts to monitor and target Ukrainian logistics. Dense forests provide ample cover for troop movements, concealed positions, and storing equipment. Moreover, Ukraine has already destroyed key bridges and river crossings in the area, further weakening Russia’s limited logistical network and complicating their ability to sustain operations.

This sets perfect conditions for a long-lasting Ukrainian incursion in the Belgorod region. Ukrainian soldiers shared videos of them moving additional forces across the border to properly reinforce and consolidate their newly gained positions.

Russian commanders understood that letting Ukrainian forces consolidate their gains would lead to another costly, grinding effort to retake the area. In response, they rushed reinforcements to the front, playing directly into Ukraine’s strategy. However, these deployments were severely hindered by Ukrainians already having destroyed several critical river crossings, resulting in predictable transport routes, allowing Ukrainian forces to easily track and target incoming Russian troops.

Geolocated combat footage from Goptarivka shows Russian soldiers hiding in the basements of 2 residential houses, before being struck by a Ukrainian precision strike. The powerful explosions leveled both structures, breaching even the basements and killing most of the soldiers. Ukrainian forces used JDAMs to destroy a Russian border post being used as an ammunition depot, along with a BMP-2 and a squad of Russian soldiers parked nearby.

Ukrainian reconnaissance drones also tracked down Russian movements, and followed them to a base, before directing several HIMARS cluster strikes onto the base, as well as on several branches of the base spread out across the forests. The strikes were devastating, as Russian munitions and equipment quickly went up in flames, and even the wounded could not make it out alive.

Additionally, the extended 28km range of the JDAM bombs allowed Ukrainian pilots to even strike targets deeper in the Russian rear, hitting a column of 5 Russian trucks transporting soldiers to the front, resulting in 60 dead recently drafted Russian soldiers, as reported by nearby Russian soldiers filming the aftermath. Another video shows Russian soldiers driving past a burning truck just recently hit by a Ukrainian strike, transporting ammunition which is slowly cooking off.

Lastly, Ukrainian forces targeted Russian trench complexes in open fields and tree lines with multiple JDAM precision bombs, striking the strongholds with devastating accuracy. Using 2-4 JDAMs per target, the goal was to eliminate entrenched Russian troops, force unit rotations, and disrupt planned operations. These strikes suggest that Ukrainians had either already neutralized higher-value targets in the rear or now possesses the operational capacity to confidently conduct precision airstrikes even on fortified Russian frontline positions.

Overall, the Ukrainian forces successfully fixed the Russian forces in the Belgorod region by forcing them to relocate forces from their Sumy offensive, forcing them to navigate through narrow, predictable logistics routes for the Ukrainians to eliminate them with precision strikes. President Zelenskyy confirmed that Ukrainian troops are operating in the Belgorod region and that they secured an area of 13sq km in Russian territory. Zelenskyy emphasized that the main goal is to safeguard the Sumy and Kharkiv regions from Russian offensives and also to continue to draw Russian resources away from the main fighting in Eastern Ukraine.

https://www.youtube.com/watch?v=-NTCnqm73Gw


15,062 posted on 04/21/2025 8:09:40 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 15061 | View Replies]

To: PIF
21APR2025 There is more and more unsold housing in new buildings in Moscow and the Moscow region
The supply of finished new buildings in Moscow and the Moscow region continues to grow, which leads to an increase in the share of unsold housing. By mid-April 2025, there are 8 thousand lots on the market of already completed apartments and flats in the capital, and 7.9 thousand in the Moscow region, the analytical service Dataflat.ru calculated at the request of Kommersant.

According to Dataflat.ru, the supply in completed new buildings in Moscow increased by 2.4% compared to last year, while the number of apartments in complexes under construction decreased by 14%, to 62.1 thousand lots. In the Moscow region, the supply in completed complexes increased by 24.3%, and the total volume of real estate for sale in new buildings increased by 22%, reaching 49 thousand lots.

According to the calculations of the analytical center “Dom.RF”, in the first quarter of 2025, the volume of housing sales in new buildings across Russia decreased by 6% year-on-year, amounting to 5.3 million square meters. In March 2025, the share of unsold housing in apartment buildings across the Russian Federation with planned commissioning this year amounted to 47%, Kommersant calculated based on data from the information system “Nash.Dom.RF”, which is the highest figure for March in the last six years. The authorities are trying to support developers by offering installments for finished housing, but experts warn of the high risks of such schemes.

https://www.kommersant.ru/doc/7674013

21APR2025 The Federal Bailiff Service has disclosed the number of cases of bans on leaving Russia due to debts
“As of March 1, 2025, orders to temporarily restrict the right of debtors to leave the Russian Federation were in effect within the framework of 9.5 million enforcement proceedings, which is almost 3 million more than as of March 1, 2024,” the FSSP said

https://www.kommersant.ru/doc/7674141

21APR2025 The number of judicial bankruptcies of citizens has increased by 35%
According to Fedresurs, consumer bankruptcies continued to grow in Russia in the first quarter. During this period, courts declared 120,990 citizens insolvent — an increase of 34.8% year-on-year. In the overwhelming majority of cases, citizens file for bankruptcy themselves (97.1% of cases), and much less often, cases are initiated by their creditors (2.3%) or the Federal Tax Service of the Russian Federation (0.6%).
https://www.kommersant.ru/doc/7673842


The economy of the Muscovy State is deteriorating at an increasing rate.

15,063 posted on 04/21/2025 9:43:22 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15061 | View Replies]

To: FtrPilot
❗️🇯🇵Japan agreed to provide satellite images to 🇺🇦Ukrainian intelligence

https://bsky.app/profile/militarynewsua.bsky.social/post/3lndnjrz3y22e

https://www.intelligenceonline.com/surveillance—interception/2025/04/21/tokyo-steps-in-to-provide-intelligence-support-for-ukraine,110436857-eve

15,064 posted on 04/21/2025 1:26:38 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15063 | View Replies]

To: AdmSmith; SpeedyInTexas

“There is more and more unsold housing in new buildings in Moscow and the Moscow region”

If official Russian Government figures show a problem, we can reliably deduce that the reality is much worse.

The anecdotal report that I posted about yesterday from a Russian firm that manufactured cable (for use in construction), recounted that new orders had dropped completely to zero in March, due to a virtual halt in new construction.

If most Russian people can’t afford mortgages now, that will only get worse as debt loads, bankruptcies and layoffs mount. Not even the Defense sector is growing in Russia anymore.

It looks like a hard landing, indeed a crash landing is in store for the Russian economy, in the coming months. 30-45% interest rates and mounting debt loads across the whole Russian economy, have locked up new investment everywhere at once.

When the crash begins in earnest (June was the last forecast I heard from the Russian Central Bank), let’s impose secondary sanctions on all Russian oil sales, and enjoy some popcorn.


15,065 posted on 04/21/2025 1:32:11 PM PDT by BeauBo
[ Post Reply | Private Reply | To 15063 | View Replies]

I bet all this Peace talk will really get you #NeverTrumps mad

Putin, once again expending an olive branch


15,066 posted on 04/21/2025 1:35:40 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15060 | View Replies]

To: BeauBo
Putin signed the law on ratification of the strategic partnership agreement with Iran

According to the document, if one of the parties is attacked, the other should not provide any assistance to the aggressor. Russia and Iran confirm their commitment to developing military-technical cooperation and conducting joint military exercises.

Putin also agreed with Iran on cooperation in order to create an independent payment infrastructure and on facilitating cooperation between the media of the two countries to “counter disinformation.” In total, the document consists of 47 articles regulating cooperation between the two countries in all key areas for the next 20 years.

https://t.me/astrapress/79445

Federal Law of 21.04.2025 No. 73-FZ "On Ratification of the Treaty on Comprehensive Strategic Partnership between the Russian Federation and the Islamic Republic of Iran"
http://publication.pravo.gov.ru/document/0001202504210001

15,067 posted on 04/21/2025 1:42:30 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15064 | View Replies]

House Armed Services Committee hearing US European Commander Cavoli

Mike Rogers Asks Military Commander: Should The DoD Maintain Current Force Posture In Europe?
https://www.youtube.com/watch?v=iZJLw90exLg

Sherrill Asks Military Official: If The War In Ukraine Ended Today, Would Russia Still Be A Threat?
https://www.youtube.com/watch?v=TVMGUCBWNpA

Mike Turner Emphasizes The Importance Of US Presence In Europe Through EUCOM
https://www.youtube.com/watch?v=RvFMGXh9n70

15,068 posted on 04/21/2025 1:44:30 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15067 | View Replies]

To: gleeaikin

Russian Offensive Campaign Assessment, April 21, 2025

Russian President Vladimir Putin rejected Ukrainian President Volodymyr Zelensky’s April 20 proposal for a temporary moratorium on long-range strikes against civilian infrastructure, declined Zelensky’s offer to extend Putin’s own 30-hour Easter truce, and attempted to justify recent Russian strikes against civilian targets in Ukraine. Zelensky stated on April 20 that Ukraine and Russia achieved a long-range strikes ceasefire between April 19 and 20 and during the day on April 20 and proposed a temporary ceasefire on long-range missile and drone strikes against civilian infrastructure for a minimum of 30 days, with the opportunity to extend the ceasefire beyond 30 days.[1] Putin announced the end of the Easter truce on April 21 and rejected Zelensky’s proposed temporary moratorium on long-range strikes against civilian infrastructure while speaking to journalists, stating that Russia would need to “sort out” the proposed civilian infrastructure strikes moratorium.[2] Putin attempted to soften his rejection of Zelensky’s ceasefire proposal by claiming that Russia and other unspecified actors need to study strikes against civilian targets where military personnel are operating and “make appropriate decisions.” Putin did not suggest the possibility of creating independent monitoring mechanisms to determine the legitimacy of such strikes, and Russian officials have previously expressed disinterest in Western-led monitoring mechanisms as a condition of future ceasefires in Ukraine.[3] Putin also attempted to justify Russia’s recent missile strikes against Ukrainian civilian infrastructure and to obfuscate his ongoing rejection of US and Ukrainian ceasefire proposals. Putin acknowledged that Russian forces recently struck civilian infrastructure in Sumy City — likely referring to the April 13 Russian missile strike against Sumy City — but suggested that the reported presence of Ukrainian military personnel in Sumy City constituted a legitimate military target.[4] Putin claimed that Russian forces also targeted Ukrainian military personnel during a recent Russian strike against Odesa City.

Putin reiterated his rejection of the full ceasefire that Zelensky and the US have offered. Zelensky reiterated on April 20 Ukraine’s readiness to agree to a full and unconditional ceasefire for a minimum of 30 days.[5] Putin rejected the full ceasefire proposal on April 21, claiming that Ukraine was attempting to “seize the initiative and talk about expan[ding]” the ceasefire, and alleging that Russia would need to “carefully evaluate everything.”[6] Ukraine and the United States initially proposed a full ceasefire on March 13, and Putin and other Russian officials have repeatedly rejected the proposal over the past five weeks.[7] The US Department of State told Reuters on April 20 that the United States would welcome the extension of the Easter truce, however.[8] US President Donald Trump expressed hope on April 20 that Russia and Ukraine would make a deal this week, possibly referring to a general ceasefire agreement that would precede future peace negotiations.[9] Kremlin Spokesperson Dmitry Peskov appeared to respond to Trump’s statement by stating that the Kremlin is not ready to discuss a time frame to end the war.[10] Putin’s continued rejection of the US-Ukrainian March 2025 proposed general ceasefire and the Kremlin’s refusal to commit to any time frame to end the war highlight Putin’s disinterest in ending the war via peace negotiations in the near term.[11] Putin’s continued rejection of US and Ukrainian ceasefire proposals runs counter to Trump’s stated approach of first establishing a ceasefire and then negotiating a broader peace agreement and to Trump’s goal of achieving a lasting peace in Ukraine.

Russian state media amplified Kherson Oblast occupation head Vladimir Saldo’s calls for additional territorial concessions from Ukraine in areas to which Russia has not yet laid formal claim. Saldo stated on April 21 to Kremlin newswire TASS that the “return” of the west (right) bank of the Dnipro River is “fundamentally important” and an “absolute priority” for Russia.[12] Saldo claimed that Ukrainian forces will continue efforts to use the east (left) bank of the river as a “lever of pressure” against Russia and that the presence of Ukrainian forces on the west bank hinders the resumption of shipping along the river. Saldo concluded that “the segment of the [Dnipro River] that passes through Kherson, Zaporizhia, and Dnipropetrovsk oblasts must be completely under [Russian] control” so as to guarantee the development of infrastructure “associated with the river.” Russian forces only currently occupy positions on the east bank of the Dnipro River in Kherson and Zaporizhia oblasts, yet Russian President Vladimir Putin has consistently demanded since June 2024 that Ukraine cede all of Zaporizhia and Kherson oblasts to Russia.[13] Saldo appears to be calling for additional Russian territorial claims along the river in central Dnipropetrovsk Oblast — an oblast that Russia has not formally claimed or illegally annexed. It is unclear how much territory along the banks of the river in Dnipropetrovsk Oblast Saldo is claiming must be under Russian control or if Saldo is implying that Russian forces must occupy extensive territory east and northeast of the river such that Russia “completely control” the river and its immediate surrounding areas. Russian forces may want to control a minimum 25 kilometers of territory on both banks of the Dnipro River so as to prevent Ukrainian forces from conducting tube artillery strikes against the area.

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-april-21-2025


15,069 posted on 04/21/2025 10:33:33 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15054 | View Replies]

To: AdmSmith

“ Russian forces may want to control a minimum 25 kilometers of territory on both banks of the Dnipro River so as to prevent Ukrainian forces from conducting tube artillery strikes against the area.”

Tragically funny statement. How many cities has Russia razed with artillery, and they want to be “protected” from Ukrainian artillery with a buffer zone?

Russian mir


15,070 posted on 04/22/2025 2:55:23 AM PDT by blitz128
[ Post Reply | Private Reply | To 15069 | View Replies]

🍈

Russian mir

Please post more. We're dying here.

15,071 posted on 04/22/2025 5:05:12 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15070 | View Replies]

To: AdmSmith

Russia reportedly delivering crude oil, diesel and wheat to Syria, in a bid to keep their Naval base at Tartus.


15,072 posted on 04/22/2025 7:56:08 AM PDT by BeauBo
[ Post Reply | Private Reply | To 15069 | View Replies]

To: BeauBo; PIF; blitz128; BroJoeK
https://www.kitklarenberg.com/p/did-ukrainian-intel-attempt-trump

Did Ukrainian Intel Attempt Trump Assassination?

Kit Klarenberg
Apr 22, 2025

For weeks, the mainstream media has been gripped by mania over Nikita Casap, a teenage resident of rural Wisconsin accused of murdering his mother and stepfather, in order to finance an elaborate scheme to assassinate US President Donald Trump and instigate a nationwide race war. News outlets have given the case blanket coverage. This has included extensive investigative timelines, psychological profiles speculating on the 17-year-old’s motives and mental state, and even cautions that federal funding cuts could prevent similar plots being foiled in future.

Eerily absent from this inexorable flurry of coverage, however, has been much if any reference to how Casap was no lone wolf, but a component of a wider conspiracy coordinated with and directed by as yet unidentified actors in Ukrainian. Even more damningly, there has been zero consideration of whether the intended assassination of Trump was one way or another orchestrated by Kiev’s security and intelligence services, in order to sabotage ongoing peace negotiations between Moscow and Washington.


15,073 posted on 04/22/2025 8:38:26 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15071 | View Replies]

To: BeauBo

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

The complete transcript.

[ Insane Russian Attack: 150 Bikes, 300 Men, Zero Survivors! ]

Today [ Apr 21, 8 pm ], there are a lot of interesting updates from the Pokrovsk direction.

Here, in one of the most bizarre offensives of the war so far, Russia just launched a massive mechanized assault near Pokrovsk, led by 150 motorcycles. After Ukrainian drones caught them mid-preparation, the operation unraveled fast, leaving the fields littered with burning bikes, wrecked armor, and stranded troops.

The goal of the Russian forces in this area is to advance and secure the key Pokrovsk-Kostyantinivka highway by advancing on the eastern flank of Pokrovsk. Earlier, the Ukrainian forces pushed them away from the positions near the highway and blew up an important stronghold at the highway intersection that the Russians previously held. Now that the weather is improving, they want to retake it to continue their advances.

To retake this key intersection, the Russians are conducting massive mechanized assaults in combination with motorcycle-based reconnaissance units leading the assaults.

The main advantage of the Russian forces in this area is the good weather, without any rain to muddy the ground, which would otherwise complicate any armored attacks. Furthermore, the intersection and its surroundings are located on a higher elevation, meaning there is less mud in the fields from previous rainy days, enabling mechanized assaults.

However, Russian maneuverability is limited by an extensive network of Ukrainian fortifications, as the Ukrainian anti-tank ditches stretch across the grey zone between the intersection and any possible Russian avenue of attack. This denies Russian units any maneuverability, as they are forced to move through a predictable bottlenecked road, which Ukrainians turned into a kill zone with land mines and tight drone observation, making any Russian assault inevitably casualty-intensive.

On top of that, the Ukrainians had also placed dragoon teeth and barbed wire fortifications in front of the intersection, meaning that any surviving Russian forces would have to stop their movement to destroy these barricades, prolonging their exposure to Ukrainian FPV drones and firing positions nearby.

Russian forces launched their assault with 150 infantry mounted on motorcycles, aiming to exploit speed and maneuverability while bypassing the Ukrainian dragon’s teeth fortifications. The bikes’ narrow frames and light weight allowed them to slip through gaps and avoid triggering anti-tank mines, which are calibrated for heavier vehicles.

This tactic reduces initial infantry losses and forces Ukrainians to engage each rider individually with FPV drones, raising the risk of some breaking through the lines. Survivors could then secure forward positions, scout Ukrainian defenses, and dismantle obstacles like barbed wire and dragon’s teeth to clear a path for advancing Russian BMPs and tanks.

However, Ukrainian drone reconnaissance already spotted the Russian motorcycle units as they prepared to assault, allowing Ukrainians to swarm the skies with FPV kamikaze drones. Striking first, Ukrainians were able to pick them off several at a time, killing over two-thirds of the riders within minutes. This likely led to a collapse of communication with the infantry component, preventing them from reporting the failed assault.

Believing the assault had succeeded, Russian commanders sent in a battalion of BMPs to reinforce the non-existent positions, only for the vehicles to be destroyed by anti-tank mines, FPV drones, and artillery fire, zeroed in on the road. This failed operation resulted in the reported loss of 21 Russian BMPs in just a few hours. Additionally, when including the failed motorcycle rush, Russians lost 96 motorcycles and a total of over 240 soldiers killed and wounded, while only approximately a third survived the assault.

Overall, the Russians attempted an assault to reclaim a highway intersection using over 150 motorcycles and dozens of armored vehicles. However, poor coordination and communication led to their defeat, with survivors scattered in the fields, and despite heavy casualties, they failed to gain any ground or achieve their goal of reaching the highway intersection.

The survivors will likely be forced to conduct meat assaults, due to their proximity to Ukrainian lines, and the Russian inability to supply the remnants of the assault, stuck in forward positions. However, without any vehicle or armored support at all, these assaults will likely only result in even more losses.

https://www.youtube.com/watch?v=oXUuVnDK4gY


15,074 posted on 04/22/2025 10:55:41 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 15072 | View Replies]

To: PIF

“Insane Russian Attack: 150 Bikes, 300 Men”

I guess that makes it 150 couples, sharing bikes.

They have been deployed for a while, without women - but even so, I find it kind of creepy.


15,075 posted on 04/22/2025 11:05:19 AM PDT by BeauBo
[ Post Reply | Private Reply | To 15074 | View Replies]

To: PIF

BREAKING:

🇺🇸🇷🇺 The US will propose officially recognizing Crimea as Russian this Wednesday in London - Washington Post pic.twitter.com/XbKcY0owYB— Megatron (@Megatron_ron) April 22, 2025


15,076 posted on 04/22/2025 11:29:11 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15073 | View Replies]

To: BeauBo; FtrPilot

Beau, we’re way behind in posts. If you would, please add a few tonight. Thanks.


15,077 posted on 04/22/2025 11:30:46 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15075 | View Replies]

Putin with yet another offer of Peace


15,078 posted on 04/22/2025 11:37:47 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15077 | View Replies]

To: FtrPilot; janetjanet998; dennisw; Grzegorz 246
Russian region declares emergency after blast at military unit https://freerepublic.com/focus/f-news/4312601/posts

(Hat Tip to Dennisw)

(Hat Tip to Janetjanet998)

Video The Russian 51st GRAU ammunition depot near Kirzhach, Vladimir region, in Russia experienced a massive explosion https://rumble.com/v6sf7md-massive-explosion-in-vladimir-region-near-moscow.html

Video Russia’s 51st GRAU arsenal suffered a violent series of secondary explosions this afternoon as a mix of stored munitions cooked off https://rumble.com/v6sf9hj-russias-51st-grau-arsenal-suffered-a-violent-series-of-secondary-explosion.html

15,079 posted on 04/22/2025 1:05:50 PM PDT by BeauBo
[ Post Reply | Private Reply | To 15075 | View Replies]

To: BeauBo

Thank you for the post and for the inclusion of both dennisw Grzegorz 246. Hopefully they will join us in the joyful destruction of globalism and the New World Order. Please include BroJoek in your next post. I miss his Walls of Text.


15,080 posted on 04/22/2025 1:36:51 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15079 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 15,041-15,06015,061-15,08015,081-15,100 ... 19,861-19,877 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson