Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 14,981-15,00015,001-15,02015,021-15,040 ... 18,521-18,525 next last
To: JonPreston
🍈


15,001 posted on 04/19/2025 6:00:31 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15000 | View Replies]

To: AdmSmith
During Russia’s massive assault on April 17, Ukrainian forces repelled a Russian attack involving two full companies, armor, motorcycles, and artillery. 229 Russians were eliminated, 34 wounded, and 24 armored vehicles, 99 motorcycles, and 2 cars destroyed.

The attack was stopped by the 14th NGU “Chervona Kalyna” Brigade, the 117th Mech Brigade, 38th Marine Brigade, and others on the Pokrovsk front.

https://x.com/NOELreports/status/1913568465849360656


15,002 posted on 04/19/2025 6:04:31 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 14996 | View Replies]

To: AdmSmith

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

The complete transcript.

[ Ukrainians Unleash Laser Air Defense Systems! ]

Today [ Apr 18, 8 pm ], there is a lot of news from the skies above Ukraine.

Here, for nearly three years, Russia’s Shahid drones have haunted Ukrainian skies, striking military and civilian targets alike, but that may be coming to an end. Today, Ukrainians deployed their latest breakthrough: a powerful new laser weapon capable of blinding, burning, and even bringing down Russian drones and missiles mid-flight.

Shahids have been used as the leading Russian strike drones for almost three years so far, and they have been used to target critical Ukrainian military and economic infrastructure, including defense industrial complexes and the Ukrainian power grid.

Ukrainian Air Force figures show that since June 2024, there has been a month-on-month increase in drone attacks, with over 4,000 launched in March. This growth has been enabled by Russia’s ability to increase domestic production of a Russified version of the Iranian Shahid drone, nicknamed Geranium. The Ukrainian Military Intelligence previously stated that Russia produced over 6,000 strike drones in 2024 and aims to increase these numbers through 2025, supplemented by a steady delivery of new Shahid drones from Iran.

The rapidly increasing production numbers and number of drones launched, is leading Ukrainians to develop new methods of countering them effectively. Originally, a large portion of the Ukrainian defense against Shahid drones comprises mobile air defense units that utilize surplus machine guns and auto-cannons mounted on pickup trucks.

Operated by civilian volunteers and specialized military units, they shoot down large number of slow-flying Shahid drones each night. Ukrainians even implemented river patrols utilizing the same weapons and tactics on the Dnipro River to protect major Ukrainian cities along the riverbank.

Additionally, Ukrainians implement improved electronic warfare systems with wider ranges, disrupting the navigation systems inside the drones, redirecting them away from civilians and military targets, into empty fields and forests.

Ukrainians are also developing more advanced systems, such as the new interceptor drones, made to catch up to the Shahid and take them down with a shotgun-like explosive. While the drone has not yet entered mass production, they have already downed 20 Russian Shahids during combat testing.

However, the peak of Ukrainian development of air defense technologies is the new high-tech air defense system Tryzub, or Trident. The laser system can destroy FPV drones, aerial bombs, cruise and ballistic missiles at a distance of 3km. Ukrainians also note that Shahids, helicopters, fighters, and even strategic bombers can be damaged or destroyed at a distance of up to 5km.

Footage of the system shows the operator’s station as the laser is guided to the target using a joystick. Additionally, the laser systems are capable of optical blinding for suppression of drones, cruise missiles, helicopters, and other aircraft at a distance of up to 10km, disrupting targeting systems of missiles and drones, while also blinding the eyesight of manned aircraft pilots.

Col.Vadym Sukharevskyi, the Ukrainian Unmanned Systems Forces commander, stated that the laser can effectively shoot down drones and ensure the defense of strategic facilities and civilian residential areas. However, the most critical information, such as the power range and the configuration of the laser beam, is classified and guarded from the public, indicating its performance may be higher than reported.

The possibility of integrating automatic or AI targeting systems like Ukrainians have done in other weapon systems would only further increase its effectiveness, as it already stands to change the field of modern air defenses. It is unknown when the Tryzub will enter full service, however, it will undoubtedly increase Ukraine’s ability to keep their skies secure.

Overall, the 3 years of experience at countering Russian drone and missile strikes led to Ukrainians making technological breakthroughs in high-tech and even futuristic anti-drone technology. Only last week, Ukrainians destroyed 229 Shahid attack drones, 145 reconnaissance drones, and 177 drones of other types, resulting in a 90% interception of Russian drones.

The development of new, futuristic laser weapons creates the possibility of increasing the interception rate to 100%, which could render the Russian drones and missiles obsolete, chastising a massive portion of Russian strike capabilities.

https://www.youtube.com/watch?v=RdSEb-eyiGw


15,003 posted on 04/19/2025 6:13:49 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 14996 | View Replies]

To: PIF

Fastest way to delay WW2 is to give Poland to hitler 😎


15,004 posted on 04/19/2025 7:25:58 AM PDT by blitz128
[ Post Reply | Private Reply | To 15003 | View Replies]

To: blitz128
The head of Chechnya presented his eldest son with the title of “honorary citizen of Grozny” Akhmat Kadyrov, 19, is the Chechen Minister of Sports. It is not known for what merits he received the title of “honorary citizen”.

https://www.kavkazr.com/a/glava-chechni-vruchil-svoemu-starshemu-synu-zvanie-pochetnogo-grazhdanina-groznogo-/33390083.html

Background
In recent months, relations between Ramzan Kadyrov and Vladimir Putin have deteriorated. A former FSB officer specializing in the North Caucasus told IStories about this, and his current colleague confirmed it. This information was partially confirmed by a North Caucasian journalist and human rights activists interviewed by IStories. According to our sources, the main reason for the discord between Kadyrov and Putin was information from the FSB about the Chechen leader's increasingly frequent and unsanctioned negotiations with representatives of Middle Eastern Muslim monarchies regarding the future of his assets and the safety of his family members.

Kadyrov has been seriously ill for a long time. As journalists from Novaya Gazeta Europe described in their investigation, he has serious kidney and pancreatic problems. The head of Chechnya understands well how power works in his region and what can await his family members in the event of his departure. He also knows the value of promises and security guarantees from the federal center.

Uncertainty about the future of his numerous relatives has forced him to seek guarantees for them in Middle Eastern Muslim countries, with whose leaders Kadyrov has long-standing friendly relations. According to IStories sources, the head of Chechnya tried to hide these negotiations from the Kremlin, which the FSB immediately learned about and reported to Putin.

https://istories.media/en/news/2025/03/27/kadyrov-kremlin-conflict/

15,005 posted on 04/19/2025 8:55:59 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15004 | View Replies]

To: BeauBo
The Tyumen Duma has prepared a draft resolution on the unification of all the people's squads of the Tyumen urban district into one. Such a measure will create a centralized management and will allow for more efficient organization of activities, the document states.

Currently, a people's militia can be created within the boundaries of municipal districts of Tyumen, so for now there are four of them: in the Eastern, Leninsky, Central, Kalininsky administrative districts and the “Cossack People's Militia of the City of Tyumen”, operating throughout the entire territory of the city district. When a decision is made, all of them will be united into the “Tyumen City People's Militia”, and participants of the disbanded structures will be invited to a single new one.

https://ura.news/news/1052919820

These are organized to protect certain groups in the event of conflict, so I say: Good luck getting them together under one command.

15,006 posted on 04/19/2025 9:02:30 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15005 | View Replies]

To: BroJoeK

Interesting to see that the recent spike in deaths began around 2 years before Feb. 24, 2022, as the birth rate continued to move down. What were the dates on the start and end of Russia’s Afghanistan adventures? It seems the lowest birth rate was in that period.


15,007 posted on 04/19/2025 9:51:12 AM PDT by gleeaikin (Question Authority: report facts, and post their links)
[ Post Reply | Private Reply | To 14993 | View Replies]

To: BroJoeK

Interesting to see that the recent spike in deaths began around 2 years before Feb. 24, 2022, as the birth rate continued to move down. What were the dates on the start and end of Russia’s Afghanistan adventures? It seems the lowest birth rate was in that period.

[This comment popped up on my stupid Chromebook, I don’t know if I posted it or not.] Meanwhile, as a further comment, I was reminded that Covid hit in 2020 which explains the Spike in deaths. Would like to see the last 3 year figures for births and deaths.


15,008 posted on 04/19/2025 10:03:25 AM PDT by gleeaikin (Question Authority: report facts, and post their links)
[ Post Reply | Private Reply | To 14993 | View Replies]

To: AdmSmith

Ben Browder on way a peace deal in Ukraine is impossible:

Putin is a little man, a dictator who has stolen too much money and started the war to divert attention of the Russian people who would have come for him. Its unrealistic to think that he would agree to a peace deal. Putin has no interest in any sort of deal because without the war the people are going to come for him.

https://www.reddit.com/r/UkraineWarVideoReport/comments/1k2bvl3/bill_browder_on_why_a_ceasefire_in_ukraine_is/?utm_source=embedv2&utm_medium=post_embed&utm_content=whitespace&embed_host_url=https://www.gopbriefingroom.com/index.php&rdt=60623


15,009 posted on 04/19/2025 10:52:08 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 15006 | View Replies]

Putin offers Peace. Zelensky refuses offer


15,010 posted on 04/19/2025 11:25:52 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15001 | View Replies]

To: AdmSmith

“The average price of Russian oil calculated for tax purposes has fallen to 4,663 roubles per barrel since the beginning of April, which is 31% below the level used to plan Russian budget revenues for 2025”

Devalue the ruble, and get more rubles for every barrel sold.

Coming soon, to a Russia near you...


15,011 posted on 04/19/2025 12:15:53 PM PDT by BeauBo (Dp)
[ Post Reply | Private Reply | To 14975 | View Replies]

To: AdmSmith

“the People’s Republic of China (PRC) is supplying Russia with weapons and military materials... the PRC has provided gunpowder and artillery to Russian forces”

Perhaps they are also backfilling North Korean shipments, using North Korea as a front to wash Chinese Military support.


15,012 posted on 04/19/2025 12:25:12 PM PDT by BeauBo (Dp)
[ Post Reply | Private Reply | To 14992 | View Replies]

To: BroJoeK

In addition to the sharp rise in Russian deaths, and the drop in their birth rate, is the exodus of people in their child-bearing years, who have emigrated to other countries.

Putin did that.

All that.


15,013 posted on 04/19/2025 12:28:36 PM PDT by BeauBo (Dp)
[ Post Reply | Private Reply | To 14993 | View Replies]

To: PIF; BeauBo

Unfortunately, a number of comments at this thread are posted by people who elsewhere are strong supporters of Putin and his war, or Russsian propaganda. Recent reports indicate our President has concluded that Putin is no serious about ending his war.


15,014 posted on 04/19/2025 12:48:31 PM PDT by gleeaikin (Question Authority: report facts, and post their links)
[ Post Reply | Private Reply | To 15009 | View Replies]

To: gleeaikin

Shaky Easter ceasefire - Kyiv Independent reports:

“Ukrainian troops were ordered to cease firing on Russian positions shortly after Russian President Vladimir Putin announced an “Easter truce” on April 19, a senior Ukrainian military officer told the BBC’s Russia service.

Putin earlier said he ordered a temporary ceasefire on Easter weekend, halting all military action from 6 p.m. Moscow time on April 19 until midnight on April 21.

Minutes after the start of the truce, Ukrainian units received orders to cease fire on Russian positions, a senior military officer reportedly told the BBC.

The officer said that troops were also ordered to document photo and video evidence of any Russian ceasefire violations and to return fire if necessary.

The Kyiv Independent could not verify these claims at the time of publication.

Following Putin’s call for an Easter truce, the Ukrainian government responded with skepticism, citing continued attacks and Moscow’s track record on ceasefire agreements.

“As for yet another attempt by Putin to play with people’s lives — an air raid alert is sounding across Ukraine right now,” President Volodymyr Zelensky said following the announcement.

Zelensky noted that air defense units were responding to ongoing Russian attacks and that Shahed-type drones had been spotted over Ukrainian territory.

Foreign Minister Andrii Sybiha said that Putin’s word was not a guarantee of a truce and called attention to Moscow’s persistent refusal to accept a full ceasefire.

“Now Putin has made statements about his alleged readiness for a ceasefire. 30 hours instead of 30 days,” Sybiha said. “Unfortunately, we have considerable experience when his statements did not coincide with his actions. We know that his words cannot be believed, and we will look at actions, not words.”

Ukraine has been willing to commit to the U.S.-proposed 30-day ceasefire on all hostilities since March 11, Sybiha said.

The suggested Easter ceasefire follows previous Russian attacks on Ukraine during major Orthodox holidays, including a deadly strike on Sumy on Palm Sunday that killed 35 people and an attack on Kharkiv during Good Friday that killed one person and injured 120.”


15,015 posted on 04/19/2025 12:54:48 PM PDT by BeauBo (Dp)
[ Post Reply | Private Reply | To 15014 | View Replies]

To: BeauBo

Believe when I see it.


15,016 posted on 04/19/2025 1:23:14 PM PDT by blitz128
[ Post Reply | Private Reply | To 15015 | View Replies]

To: gleeaikin

Russian Offensive Campaign Assessment, April 19, 2025

US officials are reportedly growing frustrated with the Kremlin’s rejections of US proposals to end the war in Ukraine. The New York Times (NYT), citing European officials who were familiar with the US discussions in Paris on April 17, reported on April 18 that the US stance on a ceasefire remains largely the same but that Russian officials have “dragged their feet” and insisted on additional conditions for US President Donald Trump’s proposed unconditional general ceasefire, including the “denazification” of Ukraine.[9] Russian President Vladimir Putin named “denazification” as one of his main goals in launching his full-scale invasion of Ukraine in February 2022, and Russian officials have previously defined “denazification” as the “liquidation of those who instill” Russophobia in other people.[10] Putin and other Kremlin officials have since reiterated this demand for “denazification” to call for regime change in Ukraine and the installation of a pro-Russian proxy government.[11] Axios reported on April 18 that two European diplomats stated that US Secretary of State Marco Rubio told UK, German, and French diplomats that President Trump is “losing his patience” and may withdraw from the peace process if a peace deal is not concluded “soon.”[12] Trump stated on April 18 that he hopes to conclude a peace deal in Ukraine “quickly” and that if either Ukraine or Russia “makes it very difficult,” then “we’re just going to take a pass.”[13] CNN reported on April 18 that a source familiar with the Trump administration stated that the Trump administration is attempting to plan another meeting between US Special Envoy to the Middle East Steve Witkoff and Russian authorities to discuss the proposed framework.[14]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-april-19-2025


15,017 posted on 04/19/2025 11:36:49 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 14992 | View Replies]

To: blitz128
Day 1,151 of the Russian invasion. 950 [average is 817/day], i.e. more than 39 Russians and Norks/h. Vehicles and fuel tanks more than 180%, and artillery more than 110% above average.


15,018 posted on 04/20/2025 12:42:07 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 14996 | View Replies]

To: AdmSmith

Only 950 casualties. Only one rank. I guess the “ceasefire” at least took the edge off the casualty rate…


15,019 posted on 04/20/2025 1:13:38 AM PDT by BeauBo
[ Post Reply | Private Reply | To 15018 | View Replies]

❗️🇺🇸Rep. Joe Wilson slams Putin's Easter “truce” as fake:“History will remember Putin as a weak and pitiful man. A war criminal bombing playgrounds & Christian bakeries, all while pretending to seek peace. He could end this invasion today—but chooses not to.”

https://x.com/front_ukrainian/status/1913852509963067901

15,020 posted on 04/20/2025 1:16:04 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15018 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 14,981-15,00015,001-15,02015,021-15,040 ... 18,521-18,525 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson