Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 14,841-14,86014,861-14,88014,881-14,900 ... 19,761-19,779 next last
Day 1,145 of the Russian invasion. 1,310 [average is 814/day], i.e. more than 54 Russians and Norks/h. AFV more than 115%, vehicles and fuel tanks more than 360%, tanks more than 100% and artillery more than 155% above average.


14,861 posted on 04/14/2025 12:05:55 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 14836 | View Replies]

To: blitz128; FtrPilot; AdmSmith

The 5 minute link in this comment goes to an interactive map showing the Russian attempt to hold on to territory and take the town of Kotlyne. This dynamic map shows Ukrianes moves and Russian countermoves in several different phases, including laying down fields of fire with machine guns where the Russians want to run their “meat waves”. It appears Ukraine gained at least 3 square km of territory in this effort. My computer then took me to a 1 hour video of the US program 60 MINUTES. The first 20 minutes were devoted to an interview with President Zelenskyy. He briefly touches on the famous Oval Office disagreement, but then gives considerable details about the many Russian attacks on civilian sites, and even hospitals. Below is the link for this video, if my Chromebook did not jump around too fast for me to actually catch it.

https://www.youtube.com/watch?v=odFTqgm0984


14,862 posted on 04/14/2025 1:42:41 AM PDT by gleeaikin (Question Authority: report facts, and post their links)
[ Post Reply | Private Reply | To 14857 | View Replies]

To: AdmSmith
Actual Nazi's sending Ukranian Neo-Nazis help in an effort to widen war.

NeverTrump Zeepers cheer.


14,863 posted on 04/14/2025 3:19:47 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14861 | View Replies]

To: blitz128; PIF
This is the person our Zeepers called a "Young Churchill"


14,864 posted on 04/14/2025 3:26:19 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14796 | View Replies]

To: AdmSmith

Ah, so “neopaganism” is the reason for Russian failures.😂

The talk of nazis like the washed up high school quarterback talks of his high school days, and the glory he had back then.


14,865 posted on 04/14/2025 4:07:43 AM PDT by blitz128
[ Post Reply | Private Reply | To 14859 | View Replies]

To: AdmSmith

Good numbers all around.
At this rate Russia will have trouble filling existing units with meat let alone create and fielding new units.

Black widows, neopaganism, nazis…. Certainly sounds like “winning”


14,866 posted on 04/14/2025 4:20:35 AM PDT by blitz128
[ Post Reply | Private Reply | To 14861 | View Replies]

🍈

Churchill!!!


14,867 posted on 04/14/2025 4:26:05 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14864 | View Replies]

To: blitz128

This is always good
https://m.youtube.com/shorts/Rb-b08JfLmE


14,868 posted on 04/14/2025 5:54:17 AM PDT by blitz128
[ Post Reply | Private Reply | To 14866 | View Replies]

To: clown

Russian Horseshoe 🧲 Tactic.


14,869 posted on 04/14/2025 6:26:39 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14867 | View Replies]

To: dimwit
🍈

"I think that without the US we will suffer many losses - both human and territorial. Such losses are possible," he said. "Without the US, there will be more losses - that's a fact," Zelensky emphasized.


14,870 posted on 04/14/2025 7:04:28 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14869 | View Replies]


14,871 posted on 04/14/2025 7:28:51 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14870 | View Replies]

To: blitz128

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

The complete transcript.

[ Ukrainians Trap Entire Russian Group! ]

Today [ Apr 13, 8 pm ], there are a lot of important updates from the Pokrovsk direction.

Here, after weeks of relentless assaults and tactical pressure, Ukrainian forces have finally sealed the ring around Kotlyne. With the encirclement now complete, they’ve begun the next phase of calculated clearing operations through the settlement’s ruins, which is already forcing Russian troops to flee, surrender, or be vanquished under drone fire and air strikes.

As you know from previous reports, Ukrainians gradually dismantled the outer layer of Russian defenses around Kotlyne, and launched a coordinated pincer operation, capturing the northern and southern parts of the settlement using thunder-run tactics. Now, it was time to fully secure the encirclement, and initiate a clearing operation to remove the remaining Russian forces from the settlement, and consolidate full control of it.

To halt Ukrainian advances and prevent them from gaining the operational initiative, Russians launched constant meat-wave assaults all over the Pokrovsk front. Through these non-stop Russian assaults and the enormous Russian numerical advantage this caused, Ukrainians were forced back into defensive operations. However, the Russians could not keep up these tactics for long, as the Ukrainians positioned themselves to drain Russian reserves as efficiently as possible, without losing their hard-fought gains, continuing to look for, and create weak spots to exploit.

One opportunity quickly presented itself, as the tempo of Russian reinforcements moving into Kotlyne was prematurely halted, due to none of them making it across the fields alive. The Ukrainians had positioned machine gun squads working in tandem with recon and kamikaze drones to turn the fields in front of Kotlyne into a kill zone, where no Russians could pass.

This allowed Ukrainian forces to successfully encircle Russian troops in Kotlyne by advancing into the town’s southern outskirts and clearing the tree belt along the railway.

The next step was softening up the industrial zone, coordinated drone strikes targeted Russian positions in the industrial zone, forcing them into hiding in basement shelters.

This was followed by JDAM-guided bomb strikes from Ukrainian Su-27’s, causing massive casualties in one of the few buildings in the industrial zone that were still standing. The combined pressure from drone and air strikes inflicted heavy Russian losses and significantly damaged their morale.

The intense Ukrainian pressure shattered Russian defenses, and as casualties quickly ramped up, and with no relief on the way, many Russian soldiers decided to abandon their positions and flee. Exposing themselves in the open fields, they were immediately detected by Ukrainian drones and swiftly eliminated.

Even minor movements between buildings were tracked in real time, leading to pinpoint strikes on Russian strongholds.

In desperation, some Russian soldiers dropped their weapons, attempting to make it back to Russian lines faster; however, as they refused to surrender, and would rather withdraw to fight another day, they were ultimately targeted and eliminated by a series of FPV kamikaze drones.

Overwhelmed by the swarm of Ukrainian drones, and without escape, several Russian soldiers opted to take their own lives instead, rather than wait for Ukrainian drones to finish the job.

With most Russian positions in Kotlyne abandoned or destroyed, Ukrainian special forces were deployed to secure the village, clear out remaining enemy combatants, and neutralize landmines and booby traps.

Encountering minimal resistance, they quickly consolidated control, eliminating a small number of Russian stragglers hiding out in basements using hand grenades and small arms fire. They also captured Russian communication equipment, which proved to be extremely useful in allowing Ukrainian units to advance further and carry out their next objectives safely.

Overall, the Ukrainians successfully cleared and consolidated control of Kotlyne and placed the remaining Russian forces in an encirclement. Remarkably, Ukrainians did this while simultaneously defending themselves from the constant Russian meat-wave assaults from the south.

Notably, even though Ukrainians have a strong defense in place to repel these assaults, it does divide Ukrainians’ attention, which is why Ukrainians are taking their time and not rushing into hurried, risky, or casualty-heavy assaults to clear Kotlyne.

This, in turn, will allow Ukrainians to keep advancing at a sustainable pace, as they slowly make their way to the besieged Russian forces in the industrial zone, and prepare for their final destruction if they refuse to surrender.

https://www.youtube.com/watch?v=Pd6ExPVj8IE


14,872 posted on 04/14/2025 7:32:58 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 14866 | View Replies]

To: PIF

Some generals better stay away from windows


14,873 posted on 04/14/2025 8:04:27 AM PDT by blitz128
[ Post Reply | Private Reply | To 14872 | View Replies]

To: PIF

“I think that without China, NK and Iran we will suffer many losses - both human and territorial. Such losses are possible,” he said. “Without china , NK, and Iran there will be more losses - that’s a fact,” pitin emphasized.😂


14,874 posted on 04/14/2025 8:07:55 AM PDT by blitz128
[ Post Reply | Private Reply | To 14872 | View Replies]

To: blitz128; PIF
Russia staged a barbaric new double Iskander-M missile strike on Ukraine today hitting a trolley bus, killing at least 32 people and leaving 83 injured. The massacre in a region close to the border between the countries left people screaming in terror. The dead and wounded - covered in blood - lay in the streets of the city centre after two massive explosions.

https://www.dailymail.co.uk/news/article-14604143/Vladimir-Putin-launches-Iskander-M-missile-strike-Ukraine.html

Кремлевская табакерка
As a token of gratitude and for protection. Belousov asked to award missile men with crosses with Putin's initials

The Minister of Defense addressed this request personally to the President. “In the last few weeks alone, valiant missile men have delivered a series of brilliant strikes against the enemy. Iskanders and our other missiles reached their targets, causing damage to the Kiev Nazis and showing the whole world the power of Russian weapons, confusing the Americans and the entire West. For such merits, the military deserve a special award, which could be crosses with your initials, Vladimir Vladimirovich,” Belousov said. He also believes that the missile men would benefit from additional protection in the form of these relics. After all, the enemy could arrange a “real hunt” for them to avenge the strikes.

It should be noted that previously, crosses with Vladimir Putin's initials engraved on them were given mainly to military personnel who were directly at the front. The President said that they effectively protect the fighters, including from American and British missiles. Vladimir Vladimirovich liked the idea of ​​awarding such crosses to the servicemen of the missile brigades. He also instructed Patriarch Kirill to hold several special prayers for the strength and success of Russian weapons. And he ordered that his initials be engraved on a batch of body icons of St. Barbara, the patroness of our missilemen. These relics will be consecrated and given to the military.

https://t.me/kremlin_secrets/5539

14,875 posted on 04/14/2025 8:45:17 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 14874 | View Replies]

To: AdmSmith

Typical Russians - very proud of their murder of innocent civilians. Russian trolls everywhere celebrate the great victory!


14,876 posted on 04/14/2025 9:09:43 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 14875 | View Replies]

To: PIF

14,877 posted on 04/14/2025 9:40:35 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14876 | View Replies]

To: PIF

14,878 posted on 04/14/2025 9:42:41 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14876 | View Replies]

🍈

A perfect example of Russia's 'horseshoe tactic' that Vlad talked about. Unable to defeat the Ukrainian army in direct battles, Russia circumvents towns and villages to cut off logistics, forcing Ukrainian forces to withdraw in order to avoid being besieged. pic.twitter.com/GDPpeSnhv8— Julian Röpcke🇺🇦 (@JulianRoepcke) April 11, 2025


14,879 posted on 04/14/2025 9:57:58 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14878 | View Replies]

To: LowIQ
🍈

TRUMP SENDS NEW MESSAGE TO ZELENSKY: “You don't start a war against somebody that is 20 times your size and then hope that people give you some missiles."



pic.twitter.com/sfpV4pf4iF— Eric Daugherty (@EricLDaugh) April 14, 2025


14,880 posted on 04/14/2025 10:04:49 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14879 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 14,841-14,86014,861-14,88014,881-14,900 ... 19,761-19,779 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson