Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 14,721-14,74014,741-14,76014,761-14,780 ... 20,301-20,311 next last
To: blitz128

That is a difficult question. At least they want Colonel General Kim Yong Bok back.

North Korea has sent Colonel General Kim Yong Bok to lead its 11,000 soldiers fighting alongside Russian forces in Ukraine, according to The Wall Street Journal. https://united24media.com/latest-news/north-korea-deploys-general-kim-yong-bok-to-lead-troops-in-ukraine-wsj-reports-3882

https://en.wikipedia.org/wiki/Kim_Yong_Bok


14,741 posted on 04/10/2025 4:23:07 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 14740 | View Replies]

To: blitz128
🔥 A fire has broken out at the oil refinery in Komsomolsk-on-Amur, Russia. The cause of the fire remains unknown.

https://x.com/NOELreports/status/1910284660480836011

Komsomolsk-on-Amur on Google Maps

A long way from Ukraine...perhaps partisans?

14,742 posted on 04/10/2025 4:23:08 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 14740 | View Replies]

To: PIF
Operators of unmanned systems from the 36th Marine Brigade are holding back Russian advances in Basivka, Sumy border region. The border village has been in a gray zone for weeks. Ukrainian forces from time to time raid into the village and take POW while Russia keeps trying to push further south.

https://x.com/NOELreports/status/1910245580330197075


14,743 posted on 04/10/2025 4:30:20 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 14742 | View Replies]

To: BeauBo
🤷🏻‍♂️ 🚁 Another Russian voenkors write that AFU used helicopter-type drones for the first time in a night attack on Naro-Fominsk near Moscow. Preliminary, this is a Ukrainian drone RZ-500.

https://x.com/Maks_NAFO_FELLA/status/1910243795142164943


14,744 posted on 04/10/2025 5:10:14 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 14743 | View Replies]


14,745 posted on 04/10/2025 5:14:56 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 14744 | View Replies]

To: FtrPilot

14,746 posted on 04/10/2025 5:59:51 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14745 | View Replies]

To: JonPreston
Dumb, Dumber and Evil


14,747 posted on 04/10/2025 6:00:16 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14746 | View Replies]

To: JonPreston
Together, they started 10 wars, killed more than one million civilians while adding nearly $7 trillion dollars to our national debt.

Donald Trump, 4 years of Peace and Prosperity while fighting the entire Global Deep State alone. President Trump is currently facing 700 years in prison for a business booking error.


14,748 posted on 04/10/2025 6:00:38 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14747 | View Replies]

To: JonPreston
Go Ukraine!

format=jpg&name=small"width=400> (LAST)

14,749 posted on 04/10/2025 6:00:58 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14748 | View Replies]

To: JonPreston


14,750 posted on 04/10/2025 6:01:29 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14749 | View Replies]

To: JonPreston
🍈


14,751 posted on 04/10/2025 6:02:15 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14750 | View Replies]

To: JonPreston

Routh , doing what he can. I wonder if he knows any Zeepers ? Does he do autographs ? Zeeper Christmas present idea, Routh’s autographed photo. Slava Ukraine !

14,752 posted on 04/10/2025 6:06:19 AM PDT by OldHarbor
[ Post Reply | Private Reply | To 14750 | View Replies]

To: AdmSmith; LowIQ
🍈

Russia continues to utilize North Korean troops in Kursk Oblast, but ISW has not yet observed indications that North Korean troops are operating as combat forces in Ukraine


14,753 posted on 04/10/2025 6:08:58 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14736 | View Replies]

To: OldHarbor

He might have been a Zeeper.


14,754 posted on 04/10/2025 6:10:09 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14752 | View Replies]

To: FtrPilot

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

The complete transcript.

[ Ukrainians Launch a Preemptive Counter-Offensive Ahead of the Russian Summer Offensive! ]

Today [ Apr 09, 8 pm ], there are important updates from the Lyman direction.

Here, Ukrainian commanders launched a preemptive counteroffensive to disrupt the Russian plans to expand their bridgeheads. With recent information that the Russians are gathering significant forces for a renewed assault, this could be another make-or-break moment for the Ukrainian defense.

The Russian military has expanded several bridgeheads across the Zherebets River and now plans to use them as stepping stones for a larger offensive, toward Borova and Liman in the coming weeks. Their objective now is to widen the crossings and bring in reinforcements to launch a broader push, once conditions allow.

With the spring mud season approaching fast, there is little time left for Russia to solidify its presence. Adding to the pressure, there is only one hardened road leading from Svatove, the main Russian logistical hub, toward Borova. If the Russians fail to secure this route and broaden their bridgehead, any serious offensive risks collapsing under logistical strain, especially once the terrain becomes impassable for armored vehicles.

Recognizing this, Ukrainian forces have taken the initiative. The Ukrainian 3rd Army Corps, particularly the 3rd Assault Brigade, is not waiting for the Russian offensive to gain momentum and materialize.

Instead, they acted to deny the Russians the opportunity to transform their fragile foothold into a viable launchpad by destroying the bridgehead before any potential assault.

As you remember, Ukrainian forces have already eliminated a significant portion of Russian artillery in the area, significantly weakening Russian fire support capabilities crucial for their offensive. Now, they are pushing forward in a determined counterattack.

Ukrainian troops have begun reclaiming positions along the 3rd Assault Brigade’s area of responsibility, as part of a deliberate effort to squeeze the Russians out. The bridgehead the Russians hold here is the narrowest along the Zherebets River line, and that makes it the most fragile.

By targeting it first, Ukraine can quickly disrupt Russian planning and roll back the line before the enemy gets a chance to exploit their foothold. Once the area is cleared, Ukrainian forces from this sector can be redeployed to bolster defenses elsewhere along the 3rd Army Corps’ zone, further complicating Russia’s offensive ambitions.

As Ukrainians push toward Raihorodka, they are regaining fire control over the only hardened road in the area, the very one Russians need to be able to move heavy equipment from Svatove to their offensive toward Borova. With the ground near the river turning to mud much earlier than on the higher elevations where Ukrainian forces are entrenched, the road becomes even more critical for Russian logistics.

If Ukraine maintains pressure and control in this area, Russia will be unable to move armored vehicles west, and the road will be reduced to a liability, constantly targeted, under fire, and of little use to a stalled Russian effort amidst worsening terrain conditions.

Drone warfare has become a defining feature of this war, and Ukraine has proven highly effective in using it both offensively and defensively. Ukrainians learned that when drone operators are forced to divide their attention between frontline combat and rear-area strikes, their impact is weakened. By focusing their drone operations on the front line now, Ukrainians will be able to push Russians back over the river, and stabilize the front. This will allow Ukrainians to then concentrate fully on targeting enemy logistics, just as they have at Pokrovsk, where focused drone attrition is steadily dismantling the Russian Pokrovsk offensive.

This counterattack, therefore, is more than a defensive response. It is a preemptive strike to collapse the foundation of a planned Russian offensive before it even begins, and timing is everything. Russian forces reportedly gathered as many as 30,000 troops for a renewed assault in the Borova-Liman direction.

If Ukraine can derail that buildup now, they will have spoiled Russian plans to advance to the Oskil River with a single, decisive campaign.

Overall, Ukraine’s counterattack along the Zherebets River is a calculated move to sabotage the foundation of Russia’s next offensive before it gets off the ground.

Turning the terrain, timing, and firepower advantage squarely in Ukraine’s favor can potentially force the Russian command to change plans for their spring campaign in this direction.

https://www.youtube.com/watch?v=EQX03R-9pZI


14,755 posted on 04/10/2025 12:12:08 PM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 14743 | View Replies]

To: PIF
🔥 An airstrike by the Ukrainian Air Force destroyed two buildings housing a Russian company command post and a security unit.

https://x.com/NOELreports/status/1910420990745792961


14,756 posted on 04/10/2025 1:16:56 PM PDT by FtrPilot
[ Post Reply | Private Reply | To 14755 | View Replies]

To: blitz128

“Curious what NK will do with soldiers sent to Russia. Having been exposed to information that they don’t get in NK”

They likely have little exposure due to the language barrier, and living in their Military unit, rather than mingling with the population. I doubt they have cell phones or Internet.


14,757 posted on 04/10/2025 1:48:30 PM PDT by BeauBo
[ Post Reply | Private Reply | To 14740 | View Replies]

To: AdmSmith

Imagine the population is getting the word that they will not live long enough t to spend that bonus, glory to dear leader/s


14,758 posted on 04/10/2025 5:54:41 PM PDT by blitz128
[ Post Reply | Private Reply | To 14703 | View Replies]

To: gleeaikin

Russian Offensive Campaign Assessment, April 10, 2025

Ukrainian President Volodymyr Zelensky stated on April 9 that Ukraine is interested in purchasing a large package of weapons from the United States, possibly within the framework of a future US-Ukraine mineral deal, as part of Ukrainian efforts to obtain security guarantees that would deter a future Russian invasion.[1] Zelensky stated on April 9 that Ukraine recently proposed to the United States that Ukraine purchase “30 to 50 billion” (likely USD) worth of air defense and weapons systems from the United States and that Ukraine is prepared to purchase these systems itself — either through direct payment to the United States or through the fund established by the potential US-Ukrainian minerals deal.[2] Zelensky stated that he recently told US President Donald Trump that Ukraine wants to buy at least 10 air defense systems to “help [Ukraine] after the end of the war” and that Ukraine will consider the provision of these air defense and weapons systems as a “security guarantee.”[3] ISW continues to assess that a strong Ukrainian military backed by Western security guarantees remains the most vital component of a stable post-war European security architecture, guaranteeing a sustainable peace in Ukraine and deterring future Russian aggression.[4]

Russia is reportedly using social media and financial incentives to recruit Chinese nationals to voluntarily join the Russian military. Ukrainian President Volodymyr Zelensky stated on April 9 that Ukrainian authorities have identified 155 Chinese citizens fighting with Russian forces in Ukraine but that there are likely many more.[13] Zelensky stated that Chinese nationals are fighting as part of the Russian 70th and 71st motorized rifle regiments (both of the 42nd Motorized Rifle Division, 58th Combined Arms Army [CAA], Southern Military District [SMD]) and the 255th Motorized Rifle Regiment (20th Motorized Rifle Division, 8th CAA, SMD). Elements of the 70th and 71st motorized rifle regiments are currently operating in western Zaporizhia Oblast, and elements of the 255th Motorized Rifle Regiment are reportedly operating in the Toretsk direction.[14] Zelensky stated that Russian forces are posting advertisements on TikTok and other Chinese social networks to recruit Chinese citizens and that the Chinese nationals traveled to Moscow, where they underwent medical examinations and one to two months of military training before deploying to Ukraine.[15] Ukraine’s Security Service (SBU) reported on April 9 that a Russian representative directly recruited one of the Chinese citizens, whom Ukrainian forces recently captured in Ukraine, in the People’s Republic of China (PRC) and that the Chinese citizen signed a contract with the Russian Ministry of Defense (MoD) upon arriving in Moscow in February 2025.[16] The SBU reported that another captured Chinese citizen went to Russia for tourism in December 2024 and signed an MoD contract after seeing an internet advertisement offering two million rubles (about $24,000) for joining the Russian military. Ukrainian outlet Kyiv Independent reported on April 9 that it viewed a Ukrainian intelligence document that stated that at least 163 Chinese citizens are serving in the Russian military as of early April 2025.[17] The Kyiv Independent reported that another document showed photos and passport details of 13 Chinese citizens fighting in the Russian military as of April 2. PRC Ministry of Foreign Affairs (MFA) Spokesperson Lin Jian stated on April 10 that the PRC MFA is unaware of the more than 155 Chinese citizens fighting with Russian forces in Ukraine.[18]

The Kremlin continues to use narratives it has historically used against Ukraine to set conditions to justify possible future aggression against Estonia. Russian MFA Spokesperson Maria Zakharova accused Estonia of conducting a “hunt” against Orthodoxy, and the MFA amplified the Russian Orthodox Church (ROC) Holy Synod’s accusations of Estonia’s persecution and oppression against Orthodox followers.[21] The Russian MFA and ROC claims come after the Estonian Parliament on April 9 passed amendments to the Churches and Congregations Act that would legally force the Estonian Orthodox Church to sever its affiliation with the ROC — Moscow Patriarchate (MP).[22] ISW has extensively reported on the Kremlin’s use of the ROC as a tool for its hybrid operations, particularly in occupied Ukraine and in former Soviet Union states, in order to repress religious freedom and promote pro-war and pro-Kremlin ideology.[23] The Kremlin has long been setting information conditions for hybrid operations against the Baltic states in the name of protecting Russian “compatriots abroad,” including against religious-based persecution, and may seek to combine and intensify these rhetorical efforts should Estonia codify these amendments into law.[24]

Radio Free Europe/Radio Liberty’s Systema project provided details on relatively elite Russian Storm-Z units comprised of penal recruits that have fought in Ukraine. Systema reported on April 9 that the Russian MoD formed three experimental elite assault units from former penal recruits: the “Storm Gladiator” detachment (58th Combined Arms Army [CAA], Southern Military District [SMD]), the “Akula” detachment, and the “Chernye Bushlaty” detachment.[88] Systema reported that that the “Storm Gladiator” detachment is primarily comprised of prisoners who had prior experience in the Russian military and security organizations, including fighters from the Chechen wars, and that the detachment consistently sustains high losses on the battlefield in Ukraine. Systema reported that the Russian military formed the “Akula” detachment in Spring 2023 and that the detachment included prisoners from maximum security penal colonies. Former Vladimir Oblast Deputy Governor Dmitry Khovstov, whom Russian authorities convicted of accepting a large bribe, was reportedly one of the detachment commanders. Systema reported that the “Chernye Bushlaty” detachment fought alongside Chechen Akhmat Spetsnaz in the industrial zone of Bilohorivka, Luhansk Oblast, in 2023 and sustained heavy losses.

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-april-10-2025


14,759 posted on 04/10/2025 9:59:53 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 14736 | View Replies]

To: AdmSmith
🇩🇪 Germany unveils a new military aid package for 🇺🇦, funded by €11B approved in March:

🔹 4 IRIS-T SAM systems (+300 missiles)
🔹 30 Patriot missiles
🔹 300 recon drones
🔹 120 MANPADS
🔹 25 Marder IFVs, 15 Leopard 1A5 MBTs
🔹 14 artillery systems, 130K 155mm shells
🔹 100 ground surveillance radars (1,100 planned)

https://x.com/NOELreports/status/1910622778417434997


14,760 posted on 04/11/2025 3:43:23 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 14759 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 14,721-14,74014,741-14,76014,761-14,780 ... 20,301-20,311 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson