Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 14,661-14,68014,681-14,70014,701-14,720 ... 20,141-20,160 next last
To: AdmSmith

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

The complete transcript.

[ Ukrainians Set an Unprecedented Artillery Kill Count to Undermine Russian Summer Offensive! ]

Today [ Apr 08, 8 pm ], there are a lot of interesting updates from the Lyman direction.

Here, Ukrainian forces shattered Russian artillery in record-breaking numbers, crippling Moscow’s plans for a massive offensive in the Borova-Lyman sector. Now, as General Drapatyi and the elite 3rd Assault Corps assemble a ferocious defensive line, incredible losses will become an inevitable reality for the Russian offensive plan.

The Russian goal is to advance to the Oskil and eliminate the major Ukrainian bridgehead here. To achieve this, they are mobilizing a massive number of troops and equipment in this sector, aiming to establish a significant numerical superiority over the Ukrainian defenders.

However, Russian offensive planning relies heavily on massive artillery barrages to pave the way for mechanized and infantry assaults. To take advantage of this, Ukrainians have prioritized the destruction of Russian artillery, aiming to disrupt Russian preparations by preventing them from conducting large preparatory barrages.

To reduce the risk of Ukrainian counter-battery fire and destruction by FPV drones and heavy-lift octocopters, Russian artillery is positioned 12-15 km behind the front lines. However, concealment remains difficult even in these rear areas, as the mostly towed artillery guns are constrained to emplacements with heavy concealment, such as the forest strips along the Krasna River.

Ukrainian drone operators use these constraining factors to make well-educated estimates of Russian firing positions, intensify drone reconnaissance in these directions, to confirm and destroy targets.

Russians often follow their artillery doctrine, which says to relocate only after coming under fire, an inflexible approach that only compounds their losses, as accurate Ukrainian drone strikes often only need one hit to disable or destroy the enemy gun.

As a result, Ukraine destroyed 1,644 Russian artillery pieces and mortars in March alone, over 3 times the monthly average of the previous 2 years. By purely targeting Russian artillery, Ukrainians are forcing the Russians to increasingly relocate and conceal their heavy guns, which significantly weakens the effectiveness of Russian fire support in and of itself.

The sharp rise in Ukrainian combat effectiveness along the eastern front is closely tied to the appointment of General Mykhailo Drapatyi as commander of the Khortytsia Operational-Strategic Group, encompassing all of Kharkiv, Luhansk, and Donetsk Oblasts. Since Drapatyi took command, Ukrainian forces have improved both their defensive coordination and battlefield resilience, resulting in a significant increase in Russian losses and operational costs.

Already in the first month of Drapatyi’s appointment, Russians required 17 assaults to take 1 square km, more than double of what it was before. By March, it soared to 36 attacks per square km, highlighting that any surge in Russian offensive action this summer will likely result in an even higher attrition rate for Russian forces.

The defense of the Borova sector specifically is significantly bolstered by the new 3rd Army Corps, formed from the Ukrainian 3rd Assault Brigade. Expanded to an entire army corps, they now enjoy greater operational autonomy and access to advanced engineering resources to build fortifications. Months of combat have provided them with intimate knowledge of the terrain, allowing them to build each defensive structure exactly where and how it is needed, and incorporate it much more effectively into their defensive operations.

At the heart of the corps is the 3rd Assault Brigade, a well-trained, disciplined, and highly motivated unit that employs NATO-style tactics tailored to the unique battlefield conditions in Ukraine. This is why the 3rd Army Corps is modeled after the operational style of the 3rd Assault Brigade.

The Army Corps command continues to integrate the remaining brigades to match the combat effectiveness of the 3rd Assault Brigade. Its professionalism and strong presence on social media have appealed to thousands of Ukrainian and foreign volunteers, attracting between 1,000-2,000 new recruits each month, significantly bolstering their numbers ahead of the Russian summer offensive.

Overall, Russian forces in the Borova-Lyman sector are preparing for a major offensive by massing artillery and experienced troops; however, they are suffering heavy losses from Ukrainian counter battery fire already before they can launch their assaults. Given the persistent attrition of Russian artillery and the surge of new recruits into the 3rd Assault Corps, Russians are likely to encounter great difficulties in breaching Ukrainian defenses once they decide to launch their summer offensive.

https://www.youtube.com/watch?v=pp1xlrlQE6Y


14,681 posted on 04/08/2025 11:24:04 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 14679 | View Replies]

To: gleeaikin

ruzzian military hardware is junk. I will have more to say after I get home.


14,682 posted on 04/08/2025 11:29:57 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 14680 | View Replies]

To: FtrPilot; blitz128; AdmSmith

Given the systematic success of small drones mopping up large strikes by killing individual Russian soldiers as they try to escape, this 143 KIA to 86 WIA figure is not surprising. This certainly seems likely given the many vidios of action against Orks I have looked at over more than a year. Often a large vehicle is hit, then you see the soldiers who are still alive fleeing to find safety, only to be systematically tracked and killed by Uke drones and small explosives. This happens as they run across fields, enter woods or trenches, or even buildings which the drone flies into, and then the building explodes.

I would not be surprised if the suggested figures of 200 to 300 Russians KIA is totally wrong. An actual figure of 1/2 million to 600,000 Russian KIA would not surprise me. Can one reason the Russians do not try to rescue the bodies of their fallen be that without a body they are only missing, NOT dead? If that is true, what a way to treat their poor worried families!


14,683 posted on 04/08/2025 11:41:17 AM PDT by gleeaikin (Question Authority: report facts, and post their links)
[ Post Reply | Private Reply | To 14667 | View Replies]

To: gleeaikin
‼️ Russia: “At a machine-building plant in the city of Aleksandrovsk (Perm Krai), workers have declared a strike, refusing to show up for shifts. The reason is a three-month wage arrears”

https://bsky.app/profile/prune602.bsky.social/post/3lmcpmtr46224

https://www.moscowtimes.ru/2025/04/08/sotrudniki-mashinostroitelnogo-zavoda-v-permi-perestali-vihodit-na-rabotu-iz-za-neviplat-zarplati-a160422

14,684 posted on 04/08/2025 12:49:12 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 14683 | View Replies]

To: gleeaikin
Why did you send me this in FRmail?


14,685 posted on 04/08/2025 1:42:39 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14683 | View Replies]

To: AdmSmith

workers have declared a strike, refusing to show up for shifts. The reason is a three-month wage arrears”

Back to the USSR again where the government pretends to pay the workers and the workers pretend to work.


14,686 posted on 04/08/2025 2:14:14 PM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 14684 | View Replies]

To: JonPreston
d9f57268cfd88afb2768d5bfa8d14557766a43a757c7a96ca74ea507ae8d4546
14,687 posted on 04/08/2025 2:42:14 PM PDT by ANKE69 ( 🇺🇲 Let's MAGA 🇺🇲)
[ Post Reply | Private Reply | To 14670 | View Replies]

To: ANKE69
These people hate Donald Trump


14,688 posted on 04/08/2025 4:05:30 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14687 | View Replies]

To: AdmSmith

All is well, tremendous GDP😎


14,689 posted on 04/08/2025 5:01:46 PM PDT by blitz128
[ Post Reply | Private Reply | To 14684 | View Replies]

To: NeverTrump; simpleton
🍈

Oil prices are down, interest rates are down (the slow moving Fed should cut rates!), food prices are down, there is NO INFLATION, and the long time abused USA is bringing in Billions of Dollars a week from the abusing countries on Tariffs that are already in place. This is…—

Donald J. Trump (@realDonaldTrump) April 7, 2025


14,690 posted on 04/08/2025 5:17:36 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14689 | View Replies]

To: JonPreston

14,691 posted on 04/08/2025 5:38:40 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14690 | View Replies]

To: JonPreston

14,692 posted on 04/08/2025 5:39:10 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14691 | View Replies]

To: JonPreston

Zelensky's curse works every time

Advice of the year: when you want to get rid of a politician, just send him or her to Zelensky. pic.twitter.com/v3UkZDr0Ob— SlavicFreeSpirit (@SlavFreeSpirit) December 16, 2024


14,693 posted on 04/08/2025 5:39:38 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14692 | View Replies]

To: JonPreston
Zelensky Curse


14,694 posted on 04/08/2025 5:40:15 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14693 | View Replies]

To: JonPreston

14,695 posted on 04/08/2025 5:40:39 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14694 | View Replies]

To: JonPreston
Dumb, Dumber and Evil

Together, they started 10 wars, killed more than one million civilians while adding nearly $7 trillion dollars to our national debt.

Donald Trump, 4 years of Peace and Prosperity while fighting the entire Global Deep State alone. President Trump is currently facing 700 years in prison for a business booking error.


14,696 posted on 04/08/2025 5:41:12 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14695 | View Replies]

To: JonPreston
Go Ukraine!


14,697 posted on 04/08/2025 5:41:43 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14696 | View Replies]

To: JonPreston


14,698 posted on 04/08/2025 5:42:10 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14697 | View Replies]

To: JonPreston

Grok says, "Don't be frightened, this is Propaganda it isn't true"


14,699 posted on 04/08/2025 5:42:32 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14698 | View Replies]

To: JonPreston
🍈


14,700 posted on 04/08/2025 5:42:58 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14699 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 14,661-14,68014,681-14,70014,701-14,720 ... 20,141-20,160 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson