Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 14,101-14,12014,121-14,14014,141-14,160 ... 19,641-19,653 next last
Canadian judges for Zelensky


14,121 posted on 03/29/2025 12:28:41 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14120 | View Replies]

To: Widget Jr

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

The complete transcript.

[ Major Scale-Up! Russians Brace For a Counteroffensive! ]

Today [ Mar 29, 8 pm ], there are a lot of interesting updates from the Borova direction.

Here, the elite 3rd Assault Brigade underwent a massive upgrade, transforming into a full-fledged army corps, already leading to massively successful counterattacks and gains. This dramatic upgrade, bolstering its combined arms and offensive capabilities with up to 20,000 new soldiers, promises to reshape the balance in the Kupiansk and Borova directions.

The Ukrainian General Staff recently completed the restructuring of the elite 3rd Assault Brigade into the new and improved Third Army Corps, which consists of 5 times as many troops and equipment, under the leadership of Andriy Biletsky. This will combine 5 existing brigades under a single command structure, where they all operate as one large body, with the 3rd Assault Brigade making up the core of the corps.

The 3rd Assault Brigade, one of Ukraine’s most effective units, has honed 3 years of combat experience and adapted NATO doctrine into modern warfare.

Recently, they showcased their strength by retaking Nadiya and surrounding areas, undoing 2 months of Russian advances and thousands of losses in a single operation.

Their coordinated counterattack combined artillery, drones, tanks, and armored assault units, each covering the other’s weaknesses. Advancing in armored personnel carriers with Leopard 2 tank support, they dismounted to clear the settlement and nearby tree lines, swiftly eliminating any Russian resistance. This operation was strategically vital, placing a key Russian supply route near Borova under Ukrainian fire control.

Expanding the 3rd Assault Brigade into a Corps increases its force from 4,000 to up to 20,000 soldiers.

Now operating under a unified 3rd Army Corps command, 5 brigades will coordinate more effectively than they could as independent ones.

Previously, brigades were Ukraine’s highest military structure, each operating with distinct doctrines, tactics, and logistical needs, which limited operational flexibility. This corps-level integration streamlines command, enhances coordination, and improves the effectiveness of large-scale operations.

Beyond the new 3rd Army Corps, Ukraine is restructuring its military into 18 individual army corps, unifying 5 to 7 brigades under a single command, covering extensive frontlines dozens of kilometers wide and deep.

Each integrating intelligence, logistics, and specialized support units, the corps enhances firepower and flexibility by assigning dedicated artillery, air defense, reconnaissance, electronic warfare, and engineering units.

With up to 20,000 personnel and 900 heavy vehicles, corps headquarters will be able to directly control front sectors and coordinate large-scale operations more effectively than independent brigades can.

The new Corps commanders benefit from superior communication and shared intelligence, enabling rapid decision-making, large-scale offensive and defensive operations, and rapid, precise responses, sending reinforcements to locations where they are most necessary. This structure turns localized engagements into coordinated operations, maximizing battlefield impact and advancing strategic objectives.

Specifically, this allowed the Ukrainian forces to eliminate several weaknesses Russians were exploiting to great effect. For example, in the Borova sector, Russians exploited the individualistic nature of the Ukrainian brigade structure to overwhelm one brigade, while launching attacks to pin down others and find gaps in the area of responsibility between two brigades.

This allowed them to greatly expand their funnel to the Oskil River at Pischane to the south. These weaknesses are now eliminated, and the Ukrainian frontline will form a much more solid line of defense for Russians to expend their reserves against.

Notably, this massive reorganization took several months, as it had to be conducted under constant Russian offensive pressure, without cohesion falling apart, which in the end was done successfully. Now that the reorganization has been completed, Ukraine is fielding many more combat-ready army corps, which severely complicates any future Russian efforts.

Overall, the Ukrainians successfully restructured the 3rd Assault and surrounding brigades into the new 3rd Army Corps. This is already yielding success, as Russians have not advanced in any direction within the new 3rd Army Corps’ area of responsibility, while Ukrainians have successfully conducted a test of their new capabilities.

Further results of the restructuring will be visible in the future, as the new 3rd Assault Corps have yet to conduct more extensive operations. The new leadership will now first focus on integrating the existing other brigades into their doctrine, train them, and prepare for new, and much larger, operations than we have seen before.

https://www.youtube.com/watch?v=4ftFZ9iyk-4


14,122 posted on 03/29/2025 1:10:22 PM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 14117 | View Replies]

To: PIF

Trump is doing his best to forge Peace. Why do you churn the embers of war? How does this support him?


14,123 posted on 03/29/2025 1:43:33 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14122 | View Replies]

To: PIF

Looks like Ukraine is developing while Russia is regressing


14,124 posted on 03/29/2025 3:05:18 PM PDT by blitz128
[ Post Reply | Private Reply | To 14122 | View Replies]

To: PIF
"We will never recognize past US military aid as debt"

Zelensky is insulting to Trump, insulting to Americans


14,125 posted on 03/29/2025 3:38:30 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14123 | View Replies]

To: dimwit
Hi, I'm Chelsea Hubbell and I love The Zelensky


14,126 posted on 03/29/2025 4:44:01 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14125 | View Replies]

To: gleeaikin
Russian Offensive Campaign Assessment, March 29, 2025

Ukrainian and US officials continue to negotiate the terms of temporary ceasefires on Black Sea operations and energy infrastructure strikes, indicating the ceasefires are not yet fully codified. Ukraine's Ministry of Energy reported on March 26 that Ukraine and the United States agreed on a list of energy facilities that Russia must stop striking during an energy infrastructure ceasefire but that the US-Ukraine list is at odds with Russia's demands.[1] The Ministry stated that Russia's list does not prohibit strikes on Ukrainian oil and gas facilities — although the Kremlin reported that the ceasefire protects Russian oil and gas facilities from strikes. Ukrainian President Volodymyr Zelensky reported on March 28 that Ukrainian Defense Minister Rustem Umerov will present US officials with evidence of Russian ceasefire violations during Umerov’s upcoming trip to the United States.[2] The exact terms of the energy infrastructure ceasefire remain unclear, as an official trilateral statement or agreement has not been released.

Zelensky stated that Turkey, Bulgaria, the United Kingdom (UK), the United States, France, Romania, and Bulgaria could act as potential ceasefire monitors, including a Black Sea moratorium, but stated that all sides “will” hold internal and international consultations regarding “readiness” to conduct monitoring.[3] US Vice President JD Vance stated on March 28 that the United States and Ukraine have “obviously” achieved an energy infrastructure ceasefire and were “almost done” negotiating a maritime ceasefire.[4] US, Ukrainian, and Russian officials all appear to be under the impression that an energy infrastructure ceasefire is currently active despite the lack of a formal trilateral agreement or any apparent agreement on the exact terms of the ceasefire.[5]

European allies continue to provide financial and materiel support to Ukraine and agreed to expand intelligence sharing with Ukraine. Ukrainian President Volodymyr Zelensky announced on March 28 that European countries agreed at the “Coalition of the Willing” summit in Paris on March 27 to expand Ukraine's access to European intelligence, relevant technologies, and satellites and that several unspecified European countries agreed to grant Ukraine an unspecified degree of access to their ammunition stockpiles.[9] Zelensky noted that Ukraine also agreed with unspecified partners on air defense production licenses, investments in Ukraine's production of drones and missiles, and to continue to work toward artillery licensing. It remains unclear whether the agreed upon licenses stipulate domestic production in Ukraine or foreign production elsewhere in Europe. Zelensky stated that the United Kingdom (UK) and Germany will organize a Ramstein meeting in April 2025. French President Emmanuel Macron pledged on March 26 to provide Ukraine with an additional military aid package valued at 2 billion euros (roughly $2.1 billion) that will include anti-tank missiles, surface-to-air missiles, air defense missiles, armored vehicles, drones, and additional Mirage fighter jets.[10] Sweden instructed its armed forces on March 28 to allocate a total of 80 million Swedish Kronor (roughly $7.5 million) to Ukraine's Demining and Drone coalitions.[11] The Danish Ministry of Defense (MoD) announced on March 27 that Denmark pledged an additional 300 million Danish Kroner (roughly $43.5 million) to a Ukrainian innovation fund that will focus on, among other things, further developing electronic warfare (EW) and drone capabilities.[12]

The Russian MoD announced the launch of the “Indra Navy 2025” exercises in Chennai, India.[82] Russian Pacific Fleet Detachment Commander Captain First Rank Alexei Antsiferov stated that the drills will test joint Russian-Indian readiness and problem-solving at sea and will begin on March 31.

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-march-29-2025

14,127 posted on 03/30/2025 3:12:58 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 14069 | View Replies]


14,128 posted on 03/30/2025 3:15:29 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 14070 | View Replies]

Day 1130 of the Russian invasion. 1,510 [Average is 808/day], i.e. more than 62 Russians and Norks/h. Vehicles and fuel tanks more than 245% and artillery more than 145% above average.


14,129 posted on 03/30/2025 3:22:38 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 14071 | View Replies]

To: blitz128

A family in Russia needs at least 74 thousand rubles a month to “make ends meet,” Rosstat calculated

https://t.me/bankrollo/40377 [ or $870 /month https://www.investing.com/currencies/usd-rub ]

Salaries in Russia have risen to a record high, but this will not happen again, analysts have warned. Compared to last year, the median salary offered has grown by 18%, from 65.4 thousand rubles in January-March 2024 to 77.2 thousand for the same period this year. Salaries have grown the most among insurers (+34%), consulting (+25%) and tourism (+20%). But we should not expect more salary growth, since businesses have almost run out of financial resources due to expensive loans. The Central Bank also warned about a halt in salary growth.

https://t.me/bankrollo/40380


14,130 posted on 03/30/2025 3:35:13 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 14124 | View Replies]

To: PIF
Кремлевская табакерка

The Central Bank has begun preparing for a “very severe crisis.” The Kremlin responded with a call to stop panicking and threatened martial law.

The Central Bank “has checked Russian banks for readiness for a collapse in oil prices and increased sanctions... Conducted stress testing of Russian banks in case of a “risk scenario” of economic development.” Such news is a harbinger of a serious crisis, our sources in the Central Bank claim. “Everything is happening as I told you ( in mid-March , - ed.). If the SVO does not end by the summer, or at the latest in June, a terrible, very severe crisis will hit the Russian economy. The banking system will mostly withstand it, but overall the situation will be tragic in places,” noted the source, who had previously predicted serious problems in the near future in conversations with Tabakerka.

According to another source close to Elvira Nabiullina, “ the SVO may well drag on . That is why we have begun preparing for the crisis. It would be extremely irresponsible not to start it, despite the fact that we are talking about something with the Americans.” At the same time, the Kremlin does not believe in the tragic scenarios from the Central Bank. “Nobody knows how long the SVO will last. But Nabiullina’s people have been panicking and whining for months now. Stop panicking! Otherwise, we will deal with the panic-mongers according to the laws of wartime,” said a high-ranking interlocutor in the Presidential Administration.

The source did not explain what he meant. But he promised that “the panic-mongers will feel it on their own skin.”

https://t.me/kremlin_secrets/5475

14,131 posted on 03/30/2025 3:38:00 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 14130 | View Replies]

To: AdmSmith

It is called stagflation.

Any business owner knows that interest rates are huge. If you are company with high debt, high interest rates are a killer, but high interest rates for consumers can be even worse. Imagine getting a mortgage at 25%, almost doesn’t matter if your pay goes up 18%. Add to that inflation 12%(reported), but likely much higher, and consumers and businesses will be in a bind. Too that off with government raising taxes and what you have is a perfect storm for economic disaster.
But hey, look at the GDP 💥


14,132 posted on 03/30/2025 4:17:50 AM PDT by blitz128
[ Post Reply | Private Reply | To 14130 | View Replies]

To: AdmSmith

Why do these sources keep talking about Moscow international airport(SVO) 🍈lol


14,133 posted on 03/30/2025 4:20:20 AM PDT by blitz128
[ Post Reply | Private Reply | To 14131 | View Replies]

To: AdmSmith

Looks like Russia is going to need a lot more “nonexistent “ help from NK.


14,134 posted on 03/30/2025 4:22:32 AM PDT by blitz128
[ Post Reply | Private Reply | To 14129 | View Replies]

To: blitz128
It is called stagflation

🍈

Another economic perspective from a high school graduate. Next up, cold-water fusion.

14,135 posted on 03/30/2025 5:01:07 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14132 | View Replies]

Slobbo Zelensky!


14,136 posted on 03/30/2025 5:07:03 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14135 | View Replies]

To: blitz128

14,137 posted on 03/30/2025 5:08:24 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14134 | View Replies]

To: AdmSmith

Since the 🍈 doesn’t bother to read your stuff the key point is this
“ The Central Bank also warned about a halt in salary growth.”

Inflation and high interest rates are not going to go away, but salary increases are, that is called stagflation.😂

Have fun with that


14,138 posted on 03/30/2025 5:15:50 AM PDT by blitz128
[ Post Reply | Private Reply | To 14130 | View Replies]

To: blitz128
🍈

😂


14,139 posted on 03/30/2025 5:20:00 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14138 | View Replies]


14,140 posted on 03/30/2025 5:24:00 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14138 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 14,101-14,12014,121-14,14014,141-14,160 ... 19,641-19,653 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson