Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 12,641-12,66012,661-12,68012,681-12,700 ... 18,661-18,674 next last
To: ETCM

To loosely borrow from A Few Good Men, “They want us on that wall, they need us on that wall.”


12,661 posted on 03/01/2025 1:31:48 PM PST by dfwgator (Endut! Hoch Hech!)
[ Post Reply | Private Reply | To 12660 | View Replies]

To: gleeaikin

Russian Offensive Campaign Assessment, March 1, 2025

Curtailing aid to Ukraine would risk diminishing US influence in the world and emboldening US adversaries. Russia, Iran, North Korea, and the People’s Republic of China (PRC) have formed a bloc aimed at defeating the United States and its allies around the world and are currently testing the limits of US commitment to its allies in Europe, the Middle East, and the Asia-Pacific region.[6] PRC President Xi Jinping stated during a phone call with Russian President Vladimir Putin in late February 2025 that the PRC and Russia are “true friends” who “cannot be moved away” from each other and will not be influenced by “any third party.”[7] Russia established bilateral comprehensive strategic partnership agreements since the start of the war with the PRC in May 2023, North Korea in October 2024, and Iran in January 2025.[8] Putin continues to rely on Iranian drones and North Korean ballistic missiles and troops in his war against Ukraine.[9] US aid to Ukraine is a demonstration of the United States’ commitment to defending democracies against ongoing and future aggression around the world, including but not limited to Ukraine, Israel, South Korea, and Taiwan. The Russia-led bloc will likely see the United States abandoning Ukraine as an indicator that the United States will abandon its other allies and will seek to test the limits of US commitment around the world. The Russia-led bloc is searching for easily exploitable divisions between the United States and its allies to isolate and weaken the United States on the global stage, allowing adversaries to rise up and dictate where and how the United States can engage the world. Cutting US aid to Ukraine plays directly into these adversaries’ goals and is a step toward curtailing US influence in the world.

The Russian MoD continues to recruit medically unfit soldiers in an effort to address personnel shortages. A Russian milblogger claimed on March 1 that Russian authorities are targeting vulnerable individuals, including those with alcoholism, developmental disabilities, and mental health disorders, through deception and coercion schemes to meet contract soldier recruitment quotas.[63] The milblogger also complained that Russian federal subject recruitment programs incentivize bringing another unwitting person to sign a military service contract and that the Russian MoD recently recruited at least one prisoner convicted of sexual crimes. The milblogger criticized the quality of these recruits and claimed that this is a systemic issue, and that the Russian military leadership is aware of and driving these issues.

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-march-1-2025


12,662 posted on 03/02/2025 2:28:38 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12637 | View Replies]

Day 1102 of the Russian invasion. 1,110 i.e. more than 46 Russians and Norks/h. Vehicles and fuel tanks more than 220% and artillery more than 130% above the average.


12,663 posted on 03/02/2025 2:35:07 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12639 | View Replies]

To: AdmSmith
🔥 Detailed footage of the destruction of a Russian ammo depot with thermobarics near Selydove. Operators of the NEMESIS regiment,alongside other units, detected and eliminated the ammo depot, a TOS "Solntsepyok," a loading vehicle, and its crew.

https://x.com/NOELreports/status/1896118235323642059


12,664 posted on 03/02/2025 4:40:58 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12663 | View Replies]

To: PIF
👊 Ukrainian Air Defence shot down 63/79 Shahed UAVs and 16 drones suppressed by EW.

https://x.com/Maks_NAFO_FELLA/status/1896127897876009017


12,665 posted on 03/02/2025 4:56:47 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12664 | View Replies]

To: PIF; FtrPilot; AdmSmith; BeauBo; gleeaikin; blitz128
Was 40-year-old Trump recruited by the KGB? Opinion by Alexander J. Motyl

Yes, I would dismiss it out of hand as just more "Russia, Russia, Russia" nonsense, this time coming straight out of the Old KGB itself.
12,666 posted on 03/02/2025 4:59:54 AM PST by BroJoeK (future DDG 134 -- we remember)
[ Post Reply | Private Reply | To 12647 | View Replies]

To: FtrPilot

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Hundreds of Explosions! Russians Lose Strategic Objects ]

Today [ Mar 01, 8 pm ], there are a lot of important updates from the Russian Federation.

Here, Russian oil refineries are going up in flames as Ukraine unleashes relentless waves of drone strikes deep into enemy territory.

With 10% of Russia’s refining capacity already offline, and more targets in sight, these attacks are beginning to cripple the Russian economy.

The most significant Ukrainian strike took place in Crimea, where Ukrainians launched over a hundred drones against Russian military airfields and air defense systems. To wear out Russian air defenses, Ukrainians deployed decoy drones, overloading Russian crews with targets and allowing the real drones to slip through.

Then, the Ukrainians destroyed a Russian Pantsir-S1 air defense system and Podlyot-K1 radar, creating a gap wide enough for the Ukrainians to devastate Russian military airfields. Ukrainians also deployed naval drones equipped with anti-air missiles and FPV drones to strike targets along the coast and deny Russian aviation the ability to fly over the Black Sea to intercept the incoming strikes.

Russians use helicopters and jets to help track and take down Ukrainian drones. With these airfields heavily bombed and Russians unable to use their aviation, Russian air defense was weakened, especially over the Black Sea and Sea of Azov, where Russian helicopters are most often deployed.

This enabled the Ukrainians to launch additional drone strikes towards the Russian oil refineries located in the Krasnodar region and southern Rostov region, flying over the Crimean Peninsula and surrounding seas with close to 80 long-range strike drones. In Tuapse, civilian reports mentioned hearing over 40 explosions near the seaport and oil refinery in the city.

Over the past weeks, Ukrainians have launched several more devastating drone strikes on Russian oil refineries and supporting infrastructure. Notably, Ukrainians hit a major oil refinery and depot in Krasnodar Krai, right under the nose of the main base of the Russian 90th Air Defense Brigade, even destroying several air defense systems during the strike.

In the Volgograd region, Ukrainians struck the main oil refinery, which refines over 14,000,000 tons of oil per year, several times over the course of many days, along with the Astrakhan gas processing plant in the area. Ukrainians launched strikes far beyond the Volgograd oblast, striking the Saratov oil refinery, which processes over 7,000,000 million tons of oil annually.

After Saratov, the Ukrainians struck the Ilsky oil refinery to the south, with a capacity of over 6,000,000 million tons of oil annually, and the Syrzan oil refinery near Samara with a capacity of almost 9,000,000 tons of oil. Ukrainians also targeted the Uzlovsky oil refinery in Tula, along with the massive oil storage facilities there.

Lastly, Ukrainians conducted a final strike on the Ryazin oil refinery, one of the largest in Russia, processing over 17,000,000 of oil annually for the 3rd time this year, causing the plant to once again halt its operations.

The targeted Russian oil refineries produce a combined 53,000,000 tons of oil annually, dealing a significant blow to the Russian economy, which is largely dependent on oil and gas exports. On top of that, the Ukrainians also targeted Russian pumping stations, striking 2 pumps in Chertkovo, and disabling the entire facility at Krasnodar.

These facilities are a critical component of the Russian oil-refining infrastructure, pumping the necessary oil to refineries that process it. Taking out the oil pumping stations will starve the still operational refineries of oil to refine while also heavily disrupting Russian exports.

Overall, since the start of Ukraine’s massive drone strike campaign targeting Russian oil refinery capabilities and infrastructure, Ukraine has taken over 10% of Russia’s oil industry offline, as Ukrainians are effectively outpacing the Russian ability to repair the damages.

Recent strikes on refineries in the Volgograd and Krasnodar regions, alone, reduced Russian oil production by over 5%. Ukraine’s success relies on mass drone production, with swarms of drones repeatedly bypassing Russian air defenses to hit major refineries, like Ryazan, several times over.

If Ukrainian strikes continue at this pace, Ukraine could disable up to 20% of Russia’s oil industry in the coming months, dealing a severe blow to the Russian economy.


12,667 posted on 03/02/2025 5:13:19 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 12665 | View Replies]

To: PIF

The percent figures are interesting. Would imagine even 80% would be enough to supply Russia and allow for reduced exports, but what interests me more is what is happening upstream.

If pumping stations are taken out, oil sits in the lines, gets thick or even freezes, and that becomes a huge problem.

Any reports on that?


12,668 posted on 03/02/2025 5:20:58 AM PST by blitz128
[ Post Reply | Private Reply | To 12667 | View Replies]

To: blitz128
🇬🇧 🇫🇷 UK PM Starmer and French President Macron have arrived at the London summit on Ukraine, per Sky News. They will soon be joined by Zelensky and leaders from Italy, Germany, Denmark, Norway, Poland, Finland, and Romania. Representatives from Canada and Turkey are also expected to attend.

https://x.com/NOELreports/status/1896184635832344648


12,669 posted on 03/02/2025 5:24:35 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12668 | View Replies]

To: BeauBo
Ukrainian forces have punched deep holes into Russian defenses in Toretsk and re-entered into large part of the city. They have already entered the ruins of the city center.

https://x.com/Tendar/status/1896189901399544029

What will ruzzia do?

Start a withdrawal or try to prevent encirclement.

12,670 posted on 03/02/2025 5:41:42 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12669 | View Replies]

To: BeauBo
After a bit of a hiatus, Ukrainian 2S7 Pions appear to have reentered the fight, seen here sending a 203mm (8 inch) shell at a Russian target.

https://x.com/Osinttechnical/status/1896022586745896971


12,671 posted on 03/02/2025 5:49:33 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12670 | View Replies]

To: FtrPilot

Doesn’t look like much of an escape route, imagine Russians will triple down on saving pocket.

Any Russian officer in the AOR who suffers this kind of defeat is 13th story window material.

Question is where will they draw the manpower from?


12,672 posted on 03/02/2025 6:03:02 AM PST by blitz128
[ Post Reply | Private Reply | To 12670 | View Replies]

To: All
BREAKING 🚨 Overwhelming majority of Americans believe that Trump and JD Vance are responsible for the White House debacle

Thank you, true patriots! 🇺🇸 🇺🇦

https://x.com/PStyle0ne1/status/1896197985853460572

An online poll published by CNN...not very reliable.

Personally, I find it almost impossible to understand President Trump's strategy.

It looks like he is surrendering to pootin.


12,673 posted on 03/02/2025 6:11:05 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12671 | View Replies]

To: blitz128
blitz128: "Question is where will they draw the manpower from?"

Excellent question.

This definitely shows that ruzzian forces are stretched thin and UKF have excellent intel of the battlefield.

12,674 posted on 03/02/2025 6:13:29 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12672 | View Replies]

To: PIF
Just another day in the Russian army's logistical nightmares: a repurposed heavy APC based on the T-80BV, equipped with an anti-drone "grill," met an anti-tank trench.

It seems it decided to make itself comfortable there.

https://x.com/wartranslated/status/1896202158875288053

ruzzian bloggers publishing videos of ruzzian junk and/or ruzzian incompetence.

12,675 posted on 03/02/2025 6:19:18 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12674 | View Replies]

To: FtrPilot; PIF; gleeaikin
Кремлевская табакерка

“A good moment to defeat Satan.” Putin is offered to ban the dollar and the euro in Russia Philosopher Alexandr Dugin has once again come forward with such an initiative . “I have already said that the dollar is Satan's currency. Yes, our relations with the United States have improved, the ruble has strengthened, but the dollar has not ceased to be the devil's currency. Therefore, I have again conveyed to Vladimir Vladimirovich a proposal to completely ban the dollar and the euro in Russia,” Alexandr Gelyevich told us. In his opinion, “a good moment has appeared to defeat the green Satan.”

“Trump may react sharply to the dollar ban. But this is unlikely to happen now. At the moment, Trump is disappointed with Zelensky, enchanted by Vladimir Vladimirovich and clearly wants to be friends with Russia. When else can he act? We also need to completely ban the euro. Europe is weak and will not be able to react to this in any way,” the philosopher added. Note that the president had previously considered Dugin’s ideas about banning enemy currencies, but did not make any decisions on this matter. According to our sources in the Kremlin, Putin will “study later” Alexandr Gelyevich’s new proposal.

https://t.me/kremlin_secrets/5360

A good idea ;-)

12,676 posted on 03/02/2025 6:53:36 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12675 | View Replies]

Russia Begins Massive Anti-China Purge, Chinese Pro-russia Fans Left Bewildered

“I just stepped out of the market and got stopped by the police. My documents were all in order, but they still accused me of having issues and immediately demanded 50,000 rubles. When I refused to pay, they smirked and threatened to take me to the police station to wait for deportation.
They specifically target Chinese people, claiming there are problems with their passport names or pinyin, just to find ways to extort more money. The moment I handed over the cash, their attitude changed completely. They grinned and said, “Welcome to Russia!”

https://www.youtube.com/watch?v=UcDcxWS5BWA
14 min video

Are these isolated incidents or does it happen generally?

12,677 posted on 03/02/2025 7:12:19 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12676 | View Replies]

To: FtrPilot

If stories of fab glide bombs being effected by EW…., one of Russias key battlefield multipliers is a big deal, and if indeed Ukrainian AirPower is increasing its effectiveness and numbers another Russian advantage may be waning


12,678 posted on 03/02/2025 7:20:58 AM PST by blitz128
[ Post Reply | Private Reply | To 12674 | View Replies]

To: AdmSmith

Interesting video


12,679 posted on 03/02/2025 7:26:41 AM PST by blitz128
[ Post Reply | Private Reply | To 12677 | View Replies]

To: FtrPilot

CNN poll: “Overwhelming majority of Americans believe that Trump and JD Vance are responsible for the White House debacle”

It looks like he is surrendering to pootin.

The whole thing was a per-arranged set up - dramatic theater designed for TV. Who could have thought of that angle?

Maybe 47 can’t say bad things about Putin in public, but he should be reassuring Zelensky in private - if 47 was actually on Zelensky’s side. A point that does not seem to be realized.

While the 47 as a sleeper KGB agent may have been debunked, still it makes one wonder if something more than a ‘peace’ deal is going on here.

I still say the only way 47’s “just and lasting peace” can be accomplished is by forcing Putin to withdraw his troops by hook or crook. Military defeat is the only thing Putin can understand, and it does not take a nuclear exchange to accomplish.

Some tine back, it was Dmitry Medvedev threatening WWIII unless UKR does a “peace deal”, now its Trump warning of WWIII unless UKR does a “peace deal”. Now what is this? A negotiation point, or something else. None of this makes sense to me.

Unless Putin and Russia are defeated, this whole Russia business will keep coming back and back like a repeating nightmare. How can the US abandon Europe to Russian influence and military aggression, and turn to Asia?

Turning one’s back on a known, proven bully, while eschewing one’s long time friends in the same fight, to take on an even larger bully, is a recipe for disaster. Does 47 plan to treat Taiwan, Japan & the Philippines in the future as he is treating the Europeans now?


12,680 posted on 03/02/2025 7:37:48 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 12673 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 12,641-12,66012,661-12,68012,681-12,700 ... 18,661-18,674 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson