Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 12,601-12,62012,621-12,64012,641-12,660 ... 18,681-18,688 next last
To: AdmSmith; SpeedyInTexas
Adm, can you pick up your posting pace?

Since 6pm yesterday, the Thread has 20 posts and I have most of them.

Thanks.

12,621 posted on 02/28/2025 8:36:29 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12620 | View Replies]

TRUMP TO ZELENSKY, MAKE A DEAL OR WE ARE OUT!!

President Trump, Vice President JD Vance and President Zelensky are getting in an extremely heated back and forth in the Oval Office. Zelensky asks Vance to come to Ukraine and Vance accuses him of doing propaganda tours. Trump tells him, “You don’t have the cards right… pic.twitter.com/Uow3tzy0gD— Kaitlan Collins (@kaitlancollins) February 28, 2025


12,622 posted on 02/28/2025 9:50:20 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12621 | View Replies]

To: AdmSmith

BTW: all this about rare earth minerals in Ukraine - apparently the biggest survey was conducted in 1946, with a smaller one in 1960. They may or may not have the minerals everyone thinks they have.

Now 47 is berating Zelenski for asking for security guarantees.


12,623 posted on 02/28/2025 10:18:53 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 12620 | View Replies]

To: PIF
Your Punk Zelensky just got thrown out of OUR White House


12,624 posted on 02/28/2025 10:27:14 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12623 | View Replies]

To: FtrPilot; BeauBo
No more funding for Zelensky and Ukraine.

Pass it on.

12,625 posted on 02/28/2025 10:36:40 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12564 | View Replies]

To: AdmSmith
HELLO, WASHINGTON? President Erdogan of Turkey has stated he will ONLY support a diplomatic solution that incorporates Ukraine's original borders-- and the status quo ante bellum. And Turkey is gearing up.

https://x.com/ChuckPfarrer/status/1895532156040143233


12,626 posted on 02/28/2025 11:30:53 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12620 | View Replies]

To: FtrPilot

Because Erdogan wants Crimea and to control The Black Sea.


12,627 posted on 02/28/2025 11:31:50 AM PST by dfwgator (Endut! Hoch Hech!)
[ Post Reply | Private Reply | To 12626 | View Replies]

To: FtrPilot

Jeepers Pilot, the ACCOMPANYING ARTICLE IS FROM Tuesday, Feb 4, 2025


12,628 posted on 02/28/2025 11:34:14 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12626 | View Replies]

To: FtrPilot

ignore the 🍈 🦠

Its news to me and good news.


12,629 posted on 02/28/2025 11:47:20 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 12626 | View Replies]

To: FtrPilot

Turkey has better Military capability to take on Russia, than Ukraine did.

One of the top ten Arms Industries.

Turkey’s economy is a mess however. Maybe Erdogan needs a distraction from that, or an excuse to clamp down domestically.


12,630 posted on 02/28/2025 12:21:30 PM PST by BeauBo ( )
[ Post Reply | Private Reply | To 12626 | View Replies]

To: BeauBo

Long term, Turkey is a much bigger threat than Russia is.


12,631 posted on 02/28/2025 12:23:46 PM PST by dfwgator (Endut! Hoch Hech!)
[ Post Reply | Private Reply | To 12630 | View Replies]

To: BeauBo

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Russian Reinforcement Ran Over And Killed an Entire Unit ]

Today [ Feb 28, 8 pm ], there are a lot of interesting updates from the Kupiansk direction.

Here, Russians made a significant effort to deploy heavily armored units to support their offensive along the Oskil River.

However, as Russian commanders sent in more and more manpower and equipment, one after the other was destroyed by Ukrainian drones, causing some Russian crews to be in such a hurry that they ran over their own soldiers in trying to escape the massacre.

The overarching goal of the Russian forces in this area is to push the Ukrainian forces beyond the Oskil River. To achieve this, Russians are trying to set conditions for an advance on both Kupiansk and Borova, by concentrating their offensive efforts around a territorial funnel at Pischane.

However, these efforts have stalled, and Russian forces are attempting to reinforce the efforts of their infantry along the riverbank with armored vehicle support, hoping this will give them the firepower advantage they need to start advancing on the two towns.

Notably, Russian forces recently expanded the Pishchane funnel to the south, securing a hardened road to provide them with more stable logistics for the fighting along the riverbank. With Ukrainian positions over 5 kilometers away, Russian logistics remain beyond the range of most Ukrainian anti-tank guided missiles.

Additionally, topographic maps show that Russian forces are advancing from higher ground, providing a significant advantage in line of sight and engagement range.

Ukrainian deep reconnaissance missions showed that Russians had been regrouping after the past failed assaults, and were readying themselves for a renewed offensive effort along the funnel. The commander of a Ukrainian drone regiment reported that Russians had started conducting reconnaissance-in-force missions to detect Ukrainian positions.

He reported that Russians would often fire over or through these reconnaissance groups, regardless of possible friendly fire, to engage the detected Ukrainian positions. The increased number of these operations alerted Ukrainians that Russians were planning their offensive soon, allowing them to prepare themselves in advance.

Ukrainians intensified their drone surveying to detect these reconnaissance-in-force assault groups, and eliminate them before they could reach Ukrainian lines and expose Ukrainian soldiers to Russian artillery fire. Out of range of Ukrainian direct-fire equipment, this early detection allowed Ukrainians to relay the Russian positions to some of the most elite drone battalions, and engage the Russian groups before they could reach the river.

Geolocated combat footage reveals how the Ukrainian kamikaze drone operators targeted Russian vehicles moving toward the river. Russians sent single tanks or armored personnel carriers through the funnel, hoping that moving in small numbers would avoid detection.

One shot shows a Ukrainian FPV kamikaze drone striking a group of bunched-up Russian soldiers dismounting from a BMP-1 infantry fighting vehicle. After the drone struck, footage from an observation drone shows how the crew of the Russian vehicle started to panic after the strike, trying to drive off before another drone arrived to finish the job.

Unfortunately for the dismounted Russian soldiers, the crew of the BMP lost all regard for the soldiers around them, reversing and crushing several soldiers, before driving off and leaving them to die.

Additional footage shows how Ukrainians targeted Ural military transport trucks as well, both with FPV drones and drone-dropped grenades, destroying all the soldiers and equipment in the unarmored vehicles.

Due to the many vehicle losses, Russian commanders also sent in soldiers on foot to reinforce their efforts along the river, which were often promptly hit by drones and grenades.

Lastly, footage shows that even the wounded on crutches were not spared being sent to the frontline, forcing Ukrainians to eliminate the slow-moving targets, as they continued to be armed and dangerous, despite their injuries.

Overall, Russians tried to build up their forces along the river bank, and launch reconnaissance-in-force operations that Ukrainian drone operators promptly dismantled. Despite finishing their reorganization, Russian commanders were apparently already short on reserves, even sending wounded soldiers to the front on crutches.

The inability of the Russians to reinforce their forces near the Oskil River with armored vehicles and infantry, will significantly reduce their combat capabilities and their ability to launch further assaults here, as Ukrainians have successfully prevented Russians from opening up a new avenue of advance.


12,632 posted on 02/28/2025 1:09:09 PM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 12630 | View Replies]

To: PIF
🍈

🇺🇦 BREAKING: Ukrainian MP Oleksandr Dubinsky just called for an Emergency Session of Ukraine’s Parliament to initiate IMPEACHMENT Proceedings against President Zelensky after the Oval Office shouting match.

This is HUGE. Zelensky’s Regime is collapsing in real time. pic.twitter.com/cWE0m5be6s— Cillian (@CilComLFC) February 28, 2025


12,633 posted on 02/28/2025 1:39:37 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12629 | View Replies]

To: dfwgator

There were US-Russia talks yesterday in Turkey. Zelensky won’t agree to Moscow’s terms and its obviosly setting off Trump who just wants the whole thing to go away. The whole bit with Vance was obvious beltway theater.


12,634 posted on 02/28/2025 1:52:21 PM PST by lodi90
[ Post Reply | Private Reply | To 12627 | View Replies]

To: PIF

Ciao.

Pretty busy here in Italy. Not much time for FR. But had an Italian tv station on. The Trump / Zelensky Oval office meeting is all over the news here.

Personally, I’m very happy. Donald C. Trump said Zelensky could come back when he wanted a peace deal. GREAT. Sounds like Trump’s ‘peace deal’ is over!!!

6 years, 51 more weeks to go.

BTW: I spent 2 HOURS to set up a simple bank account at Unicredit. I had to sign like 25 times on paper/digitally. 6 times in a row so their software could “learn” my signature. Just crazy.


12,635 posted on 02/28/2025 3:06:35 PM PST by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 12632 | View Replies]

To: gleeaikin
Russian Offensive Campaign Assessment, February 28, 2025

Russia continues to showcase its deepening relations with American adversaries despite Russian President Vladimir Putin's effort to posture Russia's receptiveness to negotiations with the United States. Russian Security Council Secretary Sergei Shoigu met separately with People's Republic of China (PRC) President Xi Jinping and PRC Foreign Minister Wang Yi in Beijing on February 28 to discuss bilateral security issues and international and regional matters.[5] Shoigu and Xi also underlined the need to continue coordinating efforts at key international platforms, including BRICS and the Shanghai Cooperation Organization (SCO), and diplomatic efforts about “solving the Ukrainian crisis.”[6] Shoigu claimed that the Russia-PRC relationship has reached “unprecedented” heights, and Russian state media highlighted statements from Xi and PRC Ministry of Foreign Affairs (MFA) Spokesperson Lin Jian’s praise of close bilateral relations.[7]

Russian Security Council Deputy Chairperson and Chairperson of the ruling United Russia party Dmitry Medvedev met with North Korea's Workers’ Party (WPK) Central Committee member Ri Hi-yong on February 26 in Moscow to express United Russia's desire “for closer cooperation with the WPK and for expanding contracts and exchanges in all areas.”[8] Russian President Vladimir Putin met with Ri on February 27, but the Kremlin's readout did not provide further details about the meeting.[9] Representatives of the Kursk Oblast Chamber of Commerce signed a cooperation agreement with the Pyongyang Chamber of Commerce on February 27 to develop bilateral economic ties and expand municipal production opportunities between Kursk Oblast and North Korean enterprises.[10] The agreement also includes trade and economic ties; cooperation in industry, agriculture, and processing; and joint logistical projects. Russia continues to align itself with adversaries of the United States, underscoring the importance of strengthening and supporting US allies and partners, including Ukraine.

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-february-28-2025

12,636 posted on 03/01/2025 3:03:36 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12606 | View Replies]

To: gleeaikin
Russian Offensive Campaign Assessment, February 28, 2025

Russia continues to showcase its deepening relations with American adversaries despite Russian President Vladimir Putin's effort to posture Russia's receptiveness to negotiations with the United States. Russian Security Council Secretary Sergei Shoigu met separately with People's Republic of China (PRC) President Xi Jinping and PRC Foreign Minister Wang Yi in Beijing on February 28 to discuss bilateral security issues and international and regional matters.[5] Shoigu and Xi also underlined the need to continue coordinating efforts at key international platforms, including BRICS and the Shanghai Cooperation Organization (SCO), and diplomatic efforts about “solving the Ukrainian crisis.”[6] Shoigu claimed that the Russia-PRC relationship has reached “unprecedented” heights, and Russian state media highlighted statements from Xi and PRC Ministry of Foreign Affairs (MFA) Spokesperson Lin Jian’s praise of close bilateral relations.[7]

Russian Security Council Deputy Chairperson and Chairperson of the ruling United Russia party Dmitry Medvedev met with North Korea's Workers’ Party (WPK) Central Committee member Ri Hi-yong on February 26 in Moscow to express United Russia's desire “for closer cooperation with the WPK and for expanding contracts and exchanges in all areas.”[8] Russian President Vladimir Putin met with Ri on February 27, but the Kremlin's readout did not provide further details about the meeting.[9] Representatives of the Kursk Oblast Chamber of Commerce signed a cooperation agreement with the Pyongyang Chamber of Commerce on February 27 to develop bilateral economic ties and expand municipal production opportunities between Kursk Oblast and North Korean enterprises.[10] The agreement also includes trade and economic ties; cooperation in industry, agriculture, and processing; and joint logistical projects. Russia continues to align itself with adversaries of the United States, underscoring the importance of strengthening and supporting US allies and partners, including Ukraine.

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-february-28-2025

12,637 posted on 03/01/2025 3:04:04 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12606 | View Replies]

To: PIF

The strange thing about any agreements on rare earth elements is that there is no shortage of them, but it is the refining process that is the bottleneck. China processes over 90%, this is what needs to be addressed, not mining.


12,638 posted on 03/01/2025 3:08:44 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12623 | View Replies]

Day 1101 of the Russian invasion. 1,050 i.e. more than 43 Russians and Norks/h. Vehicles and fuel tanks more than 200% and artillery more than 180% above the average.


12,639 posted on 03/01/2025 3:13:39 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12610 | View Replies]

To: SpeedyInTexas; BeauBo
Ciao Speedy, don't forget to say hello to BeauBo. He still isn't over the shock of thinking you were gone.

********
*********


To: JonPreston

It seems likely that Speedy may have died.

No one has heard from him, and Free Republic does draw an older crowd.

If that is the case, your posts about him are particularly distasteful and ghoulish.

Personal trolling in any event, is a violation of the rules.

9,639 posted on 12/15/2024 9:16:00 AM PST by BeauBo

12,640 posted on 03/01/2025 5:44:20 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12635 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 12,601-12,62012,621-12,64012,641-12,660 ... 18,681-18,688 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson