Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 12,181-12,20012,201-12,22012,221-12,240 ... 20,201-20,205 next last
To: JonPreston

🚨 PRESIDENT TRUMP: Where is all the money we’ve given to Ukraine??!

“We gave them I think $350 BILLION… where is all the money that’s been given? Where is it going? I don’t see any accounting!”

DOGE must dig DEEP into the endless flow of tax dollars given to Ukraine! pic.twitter.com/M7GGWqWZt4— Nick Sortor (@nicksortor) February 18, 2025


12,201 posted on 02/19/2025 6:27:27 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12200 | View Replies]

To: PIF
"Donald Chamberlain will come to the aid of his best and most trusted friend and green light their return."

That would certainly send a message.

12,202 posted on 02/19/2025 6:44:35 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12194 | View Replies]

To: PIF
Putin claims "the start of an offensive on Ukraine" from the Kursk region, claiming Russian forces have crossed the border. "The latest info I received just an hour ago says that last night, the 810th brigade crossed the Russia-Ukraine border," he stated.

Ukraine's Center for Countering Disinformation already refuted Putin's claims, calling it a plain lie.

https://x.com/NOELreports/status/1892220777816088867


12,203 posted on 02/19/2025 6:51:27 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12202 | View Replies]

To: PIF
🇺🇸 🇺🇦 Yermak met with Kellogg in Kyiv: Kellogg will be briefed on the situation on the battlefield by the military command and commanders on the ground.

❗️"Russia is trying to sow discord, to lie, to quarrel between Ukraine and the U.S. The principle of nothing about Ukraine without Ukraine is key. We are interested in the U.S. being on the side of truth and justice, and it is on our side."

https://x.com/UkrReview/status/1892227439369359484

General Kellogg did not attend the meeting in Saudi Arabia.

12,204 posted on 02/19/2025 7:18:36 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12203 | View Replies]

To: FtrPilot

That would certainly send a message.


He’s already sent a message - that of betrayal.


12,205 posted on 02/19/2025 7:59:32 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 12202 | View Replies]

To: FtrPilot

He just repeats what his generals have told him to keep him happy; they lie, he lies. Donald Chamberlain Trump trust him.


12,206 posted on 02/19/2025 8:01:36 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 12203 | View Replies]

To: FtrPilot

Yermak is a Russian agent, following in his father’s footsteps at the KGB/FSB. He was responsible for de-mining the Crimean border, allowing free entry of the Russian 57th Army at the outset of the invasion.

He is the head of the Presidential Administration which runs the country. He is not an elected official. I think he was appointed by the previous President, now residing in Russia.


12,207 posted on 02/19/2025 8:06:54 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 12204 | View Replies]

To: FtrPilot

The push today on FR seems to be to oust Zelenski, turn the country over to Yermark, then hold elections that will restore Petro Poroshenko (now residing on Russia) to the Presidency.


12,208 posted on 02/19/2025 8:46:41 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 12204 | View Replies]

To: PIF
EU countries are preparing a military aid package worth at least €6 billion for Ukraine as it seeks to shore up Kyiv’s strategic position at the outset of U.S.-led talks with Russia, according to three EU diplomats.

The package, which should include everything from 1.5 million artillery shells to air defense systems, would mark one of the EU’s largest military aid packages since Russia's full-scale invasion in 2022 and could be unveiled ahead of a highly symbolic visit by European commissioners to Kyiv on Feb. 24.

Two of the diplomats said the €6 billion was a starting point which could increase to €10 billion or more as countries dig into their inventories to see what they can send to Ukraine.

https://www.politico.eu/article/ukraine-eu-countries-target-e6b-military-aid-package/

12,209 posted on 02/19/2025 8:50:28 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12208 | View Replies]

Norway: Police call on people to report suspicious activities after intelligence-linked Russians took photos in military restricted area
Two Russians citizens took photos inside the military restricted area of Norway’s Ranger Battalion (GSV) near Kirkenes, jumped into their car and drove across the border into northern Finland where they were stopped.

https://www.thebarentsobserver.com/security/police-call-on-people-to-reportnbspsuspicious-activities-after-intelligencelinked-russians-took-photos-in-military-restrictednbsp-area/425025


12,210 posted on 02/19/2025 8:53:24 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12209 | View Replies]

To: AdmSmith

jumped into their car and drove across the border into northern Finland where they were stopped. Where they should have been unceremoniously shot dead.


12,211 posted on 02/19/2025 9:09:42 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 12210 | View Replies]

To: FtrPilot

Peace like 1939


12,212 posted on 02/19/2025 9:52:48 AM PST by blitz128
[ Post Reply | Private Reply | To 12196 | View Replies]

To: PIF

The episode happened in late April 2023, at a time when Norway still allowed Russian citizens with tourist visas to drive private cars across the border for shopping. /From the link


12,213 posted on 02/19/2025 9:57:48 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12211 | View Replies]

To: PIF; SpeedyInTexas

12,214 posted on 02/19/2025 10:14:48 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12211 | View Replies]

To: blitz128

More meat to The Grinder:

Russians taken straight from hospitals to the battlefield
https://bsky.app/profile/pstyleone1.bsky.social/post/3lijstid2dc27


12,215 posted on 02/19/2025 10:18:55 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12212 | View Replies]

To: gleeaikin; PIF; GBA; blitz128; FtrPilot; BeauBo; USA-FRANCE; canuck_conservative; marcusmaximus; ...
КОНСТИТУЦІЯ УКРАЇНИ
CONSTITUTION OF UKRAINE

(Vedomosti Verkhovna Rada of Ukraine (VVR), 1996, No. 30, p. 141)

Article 83. Regular sessions of the Verkhovna Rada of Ukraine begin on the first Tuesday of February and the first Tuesday of September of each year.
...
In the event of the announcement of a decree by the President of Ukraine on the introduction of martial law or a state of emergency in Ukraine or its individual localities, the Verkhovna Rada of Ukraine shall convene for a session within two days without convening.

In the event of the expiration of the term of office of the Verkhovna Rada of Ukraine during the state of martial law or emergency, its powers shall be extended until the day of the first meeting of the first session of the Verkhovna Rada of Ukraine elected after the abolition of the state of martial law or emergency.
...

Article 106. The President of Ukraine:

1) ensures state independence, national security and legal succession of the state;
2) addresses messages to the people and annual and extraordinary messages to the Verkhovna Rada of Ukraine on the internal and external situation of Ukraine;
3) represents the state in international relations, manages the state's foreign policy activities, negotiates and concludes international treaties of Ukraine;
4) makes decisions on the recognition of foreign states;
5) appoints and dismisses heads of diplomatic missions of Ukraine in other states and at international organizations; accepts credentials and revocable letters of diplomatic representatives of foreign states;
6) appoints an all-Ukrainian referendum on amendments to the Constitution of Ukraine in accordance with Article 156 of this Constitution, proclaims an all-Ukrainian referendum on a popular initiative; {For the official interpretation of paragraph 6 of part one of Article 106, see the Decision of the Constitutional Court No. 23-rp/2008 of 15.10.2008 }
7) call early elections to the Verkhovna Rada of Ukraine within the terms established by this Constitution;
8) terminates the powers of the Verkhovna Rada of Ukraine in cases provided for by this Constitution;
...

21) if necessary, take decisions on the introduction of a state of emergency in Ukraine or in its individual localities, and also, if necessary, declare individual localities of Ukraine as zones of an environmental emergency - with the subsequent approval of these decisions by the Verkhovna Rada of Ukraine;
...

Article 108. The President of Ukraine shall exercise his powers until the newly elected President of Ukraine assumes office.

https://zakon.rada.gov.ua/laws/show/254%D0%BA/96-%D0%B2%D1%80#Text

LAW OF UKRAINE
On the legal regime of martial law

Article 19. Guarantees of legality in martial law
1. Under martial law, the following are prohibited:
amendment of the Constitution of Ukraine ;
amendment to the Constitution of the Autonomous Republic of Crimea ;
holding elections of the President of Ukraine, as well as elections to the Verkhovna Rada of Ukraine, the Verkhovna Rada of the Autonomous Republic of Crimea and local self-government bodies;
holding all-Ukrainian and local referendums;
holding strikes, mass gatherings and rallies.

2. The Verkhovna Rada of Ukraine shall, no later than ninety days from the date of termination or cancellation of martial law, if regular or extraordinary elections to the relevant bodies were to be held during the period for which martial law was imposed, make a decision on scheduling elections of deputies of the Verkhovna Rada of the Autonomous Republic of Crimea and local elections.

https://zakon.rada.gov.ua/laws/show/389-19#n173

12,216 posted on 02/19/2025 10:49:39 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12215 | View Replies]

To: AdmSmith

The Verkhovna Rada of Ukraine is the unicameral parliament of Ukraine - to clarify what body we are talking about


12,217 posted on 02/19/2025 11:31:47 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 12216 | View Replies]

To: AdmSmith

12,218 posted on 02/19/2025 11:32:35 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12216 | View Replies]

To: FtrPilot
The warning I remember if/when Biden “won” the presidency was: “First Ukraine and then Taiwan.”

Poor Taiwan, What messages are they receiving now while watching Trump cut Ukraine, Europe and NATO loose to cozy up with Putin?

From China, the message is:

“All your base are belong to us.
Treasure what little time you have left to live ...
You have no chance to survive make your time.”
And if Trump’s recent moves are any clue, the loudest unsaid message from Trump would be: “Just surrender now and give them whatever Xi wants before China destroys you.”

Hope for the best. Prepare for the worst. These times they are a changing.

12,219 posted on 02/19/2025 1:52:30 PM PST by GBA (Endeavor to persevere. Onward through the fog …)
[ Post Reply | Private Reply | To 12202 | View Replies]

To: FtrPilot

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Total Shock! Russians Caught Completely Off Guard! ]

Today [ Feb 19, 8 pm ], there are important updates from the Pokrovsk direction.

Here, the Ukrainians launched another unexpected attack south of Pokrovsk to dismantle and counter the Russian offensive.

By taking advantage of the frozen ground, Ukrainian troops surprised the enemy and pushed them out of another key stronghold.

The planned Ukrainian counterattack at Dachenske is part of the larger strategy to take back previously lost positions around Pokrovsk, piece by piece, while Russian forces remain weakened and vulnerable. With Russian offensive capabilities significantly depleted from months of failed assaults and devastating losses, leading to the culmination of their offensive, Ukrainian forces saw an opportunity to strike before the enemy had time to reorganize.

Many of the positions that the Russians have recently captured remain poorly defended, as they have been unable to properly fortify them due to a lack of resources.

By striking now, Ukraine can not only reclaim critical positions, but also push Russian forces further away from Pokrovsk, forcing them to expend valuable resources in an attempt to consolidate gains rather than push forward. This presents a critical opportunity for the Ukrainians to continue their series of counterattacks in the region, successfully sabotaging the Russian outflanking strategy.

To achieve this, the Ukrainians are launching surprise infiltration assaults, overwhelming unprepared Russian defenders before they can react. Many Russian troops holding recently captured positions are still adjusting to new terrain, and lack established defensive fortifications. In several areas, Russian forces have been unable to properly dig in, exposing them to sudden and rapid Ukrainian counterattacks.

These assaults are purely infantry-based, relying on speed, maneuverability, and close-quarters combat to push the Russians out before they can call for reinforcements. The cold winter conditions of Donetsk Oblast play a crucial role in making this possible.

With temperatures dropping to -15 degrees Celsius, the normally muddy and impassable river has frozen over, allowing Ukrainian troops to launch surprise attacks by crossing on foot. Under normal circumstances, the river would be a natural barrier to movement, but the freezing temperatures have transformed it into a solid path for infiltration. While armored vehicles are still too heavy and would sink in the mud, infantry forces can move quickly and stealthily.

Ukrainian forces also hold key fortified positions north of the river that make these attacks even more effective, as they provide secure staging areas, complete with underground bunkers and concealed movement routes. These allow them to prepare for attacks close to the Russians, without being detected until it is too late to react on time.

Surprise plays an important role as well, as Russian forces are largely unprepared for Ukrainian counterattacks. Having spent weeks focusing on offensive operations, they are not expecting a sudden Ukrainian push.

The 68th Ukrainian Jaeger Brigade released a geolocated video about their well-planned assault on Dachenske. After days of reconnaissance and tactical preparation, Ukrainian forces decided to act while Russian defenders were still establishing their positions.

Before the assault, Ukrainian artillery pounded key enemy locations, creating chaos, and limiting Russian response capabilities. Once the shelling ended, an assault group stormed the first Russian-controlled basement, clearing it with grenades and suppressive fire, and then took it under control themselves, waiting for another Ukrainian group to storm the next one.

Due to the constant support from a drone with thermal vision, Ukrainian forces were able to locate a Russian stronghold in another house, and effectively neutralize it with a bigger explosive, dropped by a Vampire drone. Caught off guard, the Russians failed to mount an effective defense and tried to regroup, but after refusing to surrender, their forces were quickly eliminated.

Overall, Ukrainian forces are systematically reclaiming ground around Pokrovsk, weakening Russia’s offensive potential and delaying any potential breach of the city. By striking now, they force the enemy into a dilemma - either continue neglecting defensive preparations, and risk losing more key footholds, or divert already stretched resources to fortify their positions, at the cost of their failing offensive.

With each regained position, Ukraine not only disrupts Russian assault plans but also secures valuable time to reinforce Pokrovsk’s defenses, ensuring that any future Russian attempts to advance will be even more costly and difficult.


12,220 posted on 02/19/2025 1:55:06 PM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 12204 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 12,181-12,20012,201-12,22012,221-12,240 ... 20,201-20,205 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson