Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 0putinsfolly; 0putinswar; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynow; anydaynowputinwins; anydaynowrussiawins; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; jonputinbot; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 11,701-11,72011,721-11,74011,741-11,760 ... 22,121 next last
To: PIF
According to Ukrainian military sources, the amount of Lada Niva vehicles used by Russian assault units is increasing.

Shortage on Bukhanka's?

https://x.com/NOELreports/status/1889296912873820585


11,721 posted on 02/11/2025 5:30:33 AM PST by FtrPilot
[ Post Reply | Private Reply | To 11719 | View Replies]

To: BroJoeK
Americans receiving Social Security in Ukraine can enjoy a well-above average Ukrainian lifestyle.

Don't forget the ambience


11,722 posted on 02/11/2025 5:30:58 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11714 | View Replies]

To: AdmSmith
Ukraine's Air Force reports on a missile and Shahed drone attack overnight. Out of 124 Shaheds launched, 57 were shot down and another 64 (simulators/dummy's) were supressed by electronic warfare.

Results of air defense operating against cruise- and ballistic missiles is still being clarified.

https://x.com/NOELreports/status/1889232872914984978


11,723 posted on 02/11/2025 5:34:36 AM PST by FtrPilot
[ Post Reply | Private Reply | To 11721 | View Replies]

To: BroJoeK
We'll see how things turn out.

DJT has a thought on that

NEW -

Trump floats Ukraine 'may be Russian someday' ahead of Zelensky-Vance meetinghttps://t.co/OkF8DnSz0j— Insider Paper (@TheInsiderPaper) February 11, 2025


11,724 posted on 02/11/2025 5:39:08 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11720 | View Replies]

To: PIF
Destruction of a Russian military vehicle in Urazovo, Belgorod region after being hit by an FPV. Claimed as a Russian accumulation site.

https://x.com/NOELreports/status/1889262311052873829

Urazovo on Google Maps

11,725 posted on 02/11/2025 5:43:11 AM PST by FtrPilot
[ Post Reply | Private Reply | To 11723 | View Replies]

To: AdmSmith

professors from North Korean universities will travel to Moscow, Kazan, Novosibirsk, and Vladivostok cities “for a long period of time” to teach Korean in Russian universities and that Russian universities are preparing three-month internships for North Korean students


Soon to be the national language of what was once called Russia.


11,726 posted on 02/11/2025 5:44:08 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 11704 | View Replies]

To: PIF
Ukrainian forces (SBS, GUR, SSO) struck the Saratov oil refinery overnight on Feb 11 – General Staff confirms.

The refinery produces over 20 types of fuel, including diesel and gasoline, supplying the Russian army.

Confirmed hits caused a fire at the facility.

https://x.com/NOELreports/status/1889233111600247143


11,727 posted on 02/11/2025 5:48:36 AM PST by FtrPilot
[ Post Reply | Private Reply | To 11726 | View Replies]

To: BroJoeK

Putin had 1FEB2025 as the target date for regaining full control over the region after failing to meet the previous October deadline. https://freerepublic.com/focus/bloggers/4219673/posts?page=11272#11272
In your graph you can see a downward trend since mid-January, so a good guess is that they don’t have the capacity for more. Even if later attacks were planned and they would need to save weapons for those, shouldn’t they instead gather strength to fulfill Putin’s wish for 1FEB?


11,728 posted on 02/11/2025 5:49:45 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 11715 | View Replies]

To: PIF
Footage of a successful assault by the 82nd Air Assault Brigade in the Kursk region. "As a result of a swift and unexpected maneuver, new positions were secured, significantly improving the tactical situation," reports Ukraine's Air Assault Forces Command.

https://x.com/NOELreports/status/1889221433462825362


11,729 posted on 02/11/2025 5:53:23 AM PST by FtrPilot
[ Post Reply | Private Reply | To 11727 | View Replies]

To: FtrPilot

Nice hair, and typical Russian mir hypocrisy


11,730 posted on 02/11/2025 5:54:40 AM PST by blitz128
[ Post Reply | Private Reply | To 11718 | View Replies]

To: FtrPilot

More Russian GDP


11,731 posted on 02/11/2025 6:01:40 AM PST by blitz128
[ Post Reply | Private Reply | To 11723 | View Replies]

To: blitz128
"Nice hair, and typical Russian mir hypocrisy stupidity.
11,732 posted on 02/11/2025 6:03:04 AM PST by FtrPilot
[ Post Reply | Private Reply | To 11730 | View Replies]

To: FtrPilot

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Deeper Every Day! Ukrainians Advance in Kursk! ]

Today [ Feb 10, 8 pm ], the biggest news comes from the Kursk direction.

Here, Ukrainian forces launched an extensive shaping operation in preparation for their renewed offensive southeast of Sudzha, targeting Russian command posts, artillery, and logistics, designed to undermine the Russian response.

As the Ukrainian precision strikes decapitated the Russian command structure, Ukrainians were able to consolidate their gains, and have pushed up much further than initially thought.

The Ukrainian forces initiated their counteroffensive effort south of Sudzha with a series of precision strikes against the Russian artillery units, frontline logistics, and command posts, to delay their response to the Ukrainian assaults.

First, Ukrainians detected and launched a precision strike against a Russian command post with ATACMS missiles, which resulted in the elimination of key Russian officers responsible for coordinating and planning their operations in the Kursk salient.

Ukrainian President Volodymyr Zelensky later confirmed this, and stated that the Ukrainian strike against a Russian command post, successfully killed dozens of Russian and North Korean officers, severely undermining the Russian command and control structure in Kursk.

Ukrainians also decided to target Russian artillery systems to simultaneously undermine the Russian artillery support capabilities. Geolocated footage from the area reveals how the Ukrainian drone operators successfully hunted down and destroyed a rare Russian 2S42 Malva self-propelled gun with an FPV kamikaze drone.

More footage shared by Russian soldiers showed a Grad multiple rocket launch system burning and cooking off, after another successful Ukrainian strike.

Lastly, Ukrainians targeted Russian logistics and reinforcement routes closer to the front, causing preliminary Russian positions to run low on manpower and ammunition before the Ukrainain assaults. Combat footage reveals the destruction of Russian forces’ accumulations and reinforcement routes by drone strikes from Plekhovo to Giri, undermining the Russian capability to adequately respond to the Ukrainian attacks.

The main goal of the Ukrainian forces for the next day of their renewed counteroffensives was to build on their gains from the previous day, capitalizing on the temporary disruption and disorganization among the Russian forces.

This is in continued pursuit of their goal of gaining a larger buffer zone south of Sudzha, denying Russians an easy assault vector into the town, and forcing them to conduct drawn-out grinding battles to retake the territory. By expanding their control area, the Ukrainian forces could also secure positions along the Psel River and fortify them, denying Russian forces any chance of easily attacking and entering the southern part of Sudzha.

However, with the threat of Russian fiber-optic controlled drones, which are immune to any current form of electronic countermeasures, Ukrainians opted not to launch more mechanized assaults, as reports indicated that Russians had transferred a significant amount of drone detachments to counter further Ukrainain mechanized threats.

Instead, Ukrainian soldiers utilized the cover of the forests to protect them from fiber optic drones, effectively advancing and eliminating the remaining Russian forces that attempted to organize resistance in the forest belts, near the Ukrainian gains.

Furthermore, recently published footage from Russian drone operators, indicates that Ukrainians have advanced much further than initially thought, as Russian sources indicate they are struggling to contain the situation in Ulanok.

Overall, Ukrainians conducted an incredibly effective shaping operation in preparation for their counterattacks south of Sudzha, and continued to gain ground with each day.

The decapitation of the Russian command structure, the strikes on Russian artillery and counter-battery capabilities, and the undermining of Russian frontline positions’ logistics network all played a crucial role in the sudden success of Ukrainian forces here.

Continued operations in this area will allow the Ukrainian forces to advance further east while forming a powerful line of defense along the Psel River.


11,733 posted on 02/11/2025 6:04:18 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 11725 | View Replies]

To: AdmSmith

Maybe he meant 1 feb 2026😎


11,734 posted on 02/11/2025 6:04:22 AM PST by blitz128
[ Post Reply | Private Reply | To 11728 | View Replies]

To: All
Ukraine has reportedly agreed to provide the U.S. with $500B worth of rare earth minerals in exchange for military aid, Trump claims.

"They can make a deal or not, become Russian or not, but our money is there. And I said I want it back."

Trump also confirmed envoy Kellogg's visit to Ukraine on Feb 20.

https://x.com/NOELreports/status/1889220333447589945

pootin puffers are hardest hit.

11,735 posted on 02/11/2025 6:07:12 AM PST by FtrPilot
[ Post Reply | Private Reply | To 11732 | View Replies]

To: FtrPilot

Maybe 🍈 works for 60 minutes, likes to edit quotes 😂


11,736 posted on 02/11/2025 6:10:08 AM PST by blitz128
[ Post Reply | Private Reply | To 11735 | View Replies]

To: PIF
Russian Telegram channels report a large fire at an oil refinery in Saratov after a drone attack.

https://x.com/Gerashchenko_en/status/1889208746976461011

The video shows a large searchlight looking for drones.


11,737 posted on 02/11/2025 6:15:36 AM PST by FtrPilot
[ Post Reply | Private Reply | To 11735 | View Replies]

To: blitz128
One of the Russian assaults group which attempted to attack Ukrainian positions on the Siversk front without any vehicle support.

https://x.com/bayraktar_1love/status/1889237731668058183

So, now the ruzzians are running short of Ladas.

11,738 posted on 02/11/2025 6:21:24 AM PST by FtrPilot
[ Post Reply | Private Reply | To 11737 | View Replies]

To: PIF
🚗👀 On the Pokrovsk direction, the Russian left an entire fleet of vehicles on the road, - KUP

🔥 On the road from Pustinka to Hryhorivka, on a strip of land just 1.5 km long, the Russians left 35 destroyed vehicles and 1 APC.

https://x.com/Maks_NAFO_FELLA/status/1889275666874458400

Hryhorivka on Google Maps

11,739 posted on 02/11/2025 6:33:27 AM PST by FtrPilot
[ Post Reply | Private Reply | To 11738 | View Replies]

To: AdmSmith; FtrPilot; blitz128; BeauBo; PIF; BroJoeK

A detailed written report in English regarding development, testing and modification of this French weapon, the AASM Hammer. It includes 44 References for those who like to dig deep


11,740 posted on 02/11/2025 6:34:39 AM PST by gleeaikin ( Question authority as you provide links )
[ Post Reply | Private Reply | To 11669 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 11,701-11,72011,721-11,74011,741-11,760 ... 22,121 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson