Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 11,261-11,28011,281-11,30011,301-11,320 ... 18,761 next last
To: PIF

They released the date now to convince us that they are simply stupid, not incompetent.


11,281 posted on 02/02/2025 9:06:25 AM PST by FtrPilot
[ Post Reply | Private Reply | To 11280 | View Replies]

To: FtrPilot

... convince us that they are simply stupid, not incompetent.

I’m not convinced - need more evidence


11,282 posted on 02/02/2025 9:07:54 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 11281 | View Replies]

To: Mr. Lucky

Jeepers Mr Lucky!


11,283 posted on 02/02/2025 10:48:46 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11279 | View Replies]

To: BeauBo

JUST IN: Ukrainian President Zelensky says Ukraine only received around $75 billion of the $177 billion in aid sent by the United States.

"I don't know where all this money is."

pic.twitter.com/O5EVwkFAt0— BRICS News (@BRICSinfo) February 2, 2025


11,284 posted on 02/02/2025 11:41:46 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11283 | View Replies]

To: PIF
Explosions in Rostov region, air defense is active against Ukrainian drones.

https://x.com/NOELreports/status/1886143938827845695


11,285 posted on 02/02/2025 12:26:26 PM PST by FtrPilot
[ Post Reply | Private Reply | To 11281 | View Replies]

To: PIF
Explosions in Bryansk region. Additionally, reports of lots of explosions in both Tokmak and Berdyansk.

https://x.com/NOELreports/status/1886147436281753810


11,286 posted on 02/02/2025 12:26:58 PM PST by FtrPilot
[ Post Reply | Private Reply | To 11285 | View Replies]

To: PIF
"I’m not convinced - need more evidence"

Evidence that ruzzians are stupid and incompetent.

Kursk region

Russian troops have tried to retake Pogrebky in recent weeks. It is now clear - based on Russian sources - that Ukraine has full control over the frontline village and has slightly expanded the zone of control.

https://x.com/NOELreports/status/1886146931723800665

Pogrebki on Google Maps


11,287 posted on 02/02/2025 12:33:18 PM PST by FtrPilot
[ Post Reply | Private Reply | To 11282 | View Replies]

To: FtrPilot

Evidence that ruzzians are stupid and incompetent?


yes. stupidly incompetent. or is it spectacularly stupidly incompetent?


11,288 posted on 02/02/2025 12:43:13 PM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 11287 | View Replies]

We told you for three years that the Ukraine was a Biden money laundering scheme, remember?

Breaking: Zelensky Turns on Democrat Deep State, Says 58% of Ukraine War/Aid Funds Stolen by Washington Insiders -- Must-Watch & Share Feed! https://t.co/YZzAGwvKm0— Alex Jones (@RealAlexJones) February 2, 2025


11,289 posted on 02/02/2025 3:09:16 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11288 | View Replies]

UKRAINE: What if 58% of the U.S. taxpayer dollars sent to Zelensky never even reached Ukraine? Where did it go? Did the CIA skim a cut? Did Ukrainian officials and generals pocket their share? Did The Big Guy get his usual slice? If Zelensky's claim is true—that he only received… pic.twitter.com/PYyZ9HOQ4M— @amuse (@amuse) February 2, 2025


11,290 posted on 02/02/2025 4:43:05 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11289 | View Replies]

To: PIF

🍈🦆😂


11,291 posted on 02/02/2025 5:06:41 PM PST by blitz128
[ Post Reply | Private Reply | To 11280 | View Replies]

To: blitz128

11,292 posted on 02/02/2025 6:09:17 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11291 | View Replies]

To: gleeaikin
Russian Offensive Campaign Assessment, February 2, 2025

Russia continues efforts to illegally deport Ukrainian children to occupied Crimea and Russia under the guise of evacuation and rehabilitation programs. Ukrainian Presidential Advisor on Children's Issues Daria Herasymchuk reported on February 2 that Russia has illegally deported at least 20,000 Ukrainian children since 2022 and that Ukraine has repatriated 1,189 children with support from humanitarian organizations and Qatar, South Africa, and the Vatican.[7] Herasymchuk stated that Russian authorities have killed Ukrainian parents, kidnapped their children, and transported the children to “rehabilitation” or “evacuation” camps in occupied Crimea. Herasymchuk stated that Russian authorities have also separated children from their families in illegal filtration camps. Ukraine's Regional Human Rights Center identified 13 such “rehabilitation” or “evacuation” camps in occupied Crimea alone. Russian authorities reportedly use the camps in occupied Crimea to indoctrinate and militarize Ukrainian children before further deporting them to Russia for adoption. Herasymchuk warned that Russian authorities are increasingly attempting to mobilize Ukrainian teenage boys into the Russian military - a violation of the Geneva Convention.[8] ISW has reported extensively on Russia's crimes in occupied Ukraine, including the forced deportation of Ukrainian children to Russia.[9] The United Nations Genocide Convention Article 2 defines “forcibly transferring children of a group to another group” as an act constituting genocide.[10]

Russian forces continue to forcibly mobilize civilians in occupied Ukraine into the Russian military in violation of the Geneva Convention. Ukraine's Main Military Intelligence Directorate (GUR) reported on February 2 that Russian occupation authorities forcibly mobilized around 300 Ukrainian civilians from occupied Kherson and Zaporizhia oblasts to the Russian military between October 31 and December 31, 2024.[51] The GUR, citing the Ukrainian “I Want to Live” hotline, reported that Russian authorities deployed 30 Ukrainian civilians from occupied Kherson and Zaporizhia oblasts to an unspecified military unit in occupied Crimea in Fall 2024. The GUR noted that the mobilized Ukrainian civilians face systematic abuse and poor living conditions. Article 51 of the Geneva Convention explicitly prevents an occupying power from compelling the population it occupies to serve in the occupying power's military, including via “pressure or propaganda which aims at securing voluntary recruitment.”[52]

A Russian milblogger continued to complain about Russian command failures within the 20th Combined Arms Army (CAA) (Moscow Military District) that led to the Russian Ministry of Defense's (MoD) premature announcement of the seizure of Novoyehorivka (southeast of Borova).[53] A Russian milblogger claimed on February 2 that Russian military personnel operating near Novoyehrovika reported that one company in the 20th CAA’s 3rd Motorized Rifle Division had only 30 personnel left following recent assaults and lacked ammunition and that the 3rd Motorized Rifle Division's 252nd Motorized Rifle Regiment suffered heavy losses in “stupid” assaults.[54] The milblogger claimed that Russian military authorities postponed efforts to resolve systemic problems within the Russian military leadership following Ukraine's incursion into Kursk Oblast in August 2024.

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-february-2-2025

11,293 posted on 02/03/2025 2:50:42 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 11265 | View Replies]

To: AdmSmith

11,294 posted on 02/03/2025 2:53:04 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 11266 | View Replies]

Similar to yesterday: 1,300 i.e. more than 54 Russians and Norks/h. Vehicles and fuel tanks + artillery systems more than 100% above the average.


11,295 posted on 02/03/2025 3:24:08 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 11267 | View Replies]

To: AdmSmith

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Massive Russian Assault Obliterated in Seconds ]

Today [ Feb 02, 8 pm ], there are a lot of interesting updates from the Pokrovsk direction.

Here, Russians attempted to launch a surprise all-infantry assault of over 70 soldiers, hoping that the dense fog would conceal their movements.

However, with advanced detection capabilities, Ukrainians showed restraint, waiting till Russians had bunched up all of their troops on a narrow bridge before unleashing a hellish barrage of artillery shells on the completely unaware Russian soldiers.

The main goal of Russian forces is to take control of the village of Uspenivka. By this, Russians are attempting to undercut Ukrainian positions in Udachne, to open up a new vector of assault, and to overcome their lack of progress on the western flank of Pokrovsk.

Taking Uspenivka first will also allow them to secure the flank of their northern vector, decreasing the risky nature of their open-field assaults. To accomplish this, Russians are launching pure infantry assaults to dislodge Ukrainian defenders.

To launch their large attacks, Russians are trying to accumulate large infantry groups in the nearby village of Novovasylivka, using the proximity to Uspenivka to their advantage. As Russians severely outnumber Ukrainians, they plan to completely overwhelm the defenders in Uspenivka through sheer numbers, as their growing lack of armor forces Russians to rely evermore on pure infantry assaults.

To avoid Ukrainian detection, Russians are also increasingly relying on foggy weather conditions to move small infantry groups together and slowly accumulate a much larger assault force for their attacks.

However, Ukrainians are cleverly countering this Russian tactic by using drones equipped with thermal cameras for when the fog gets too dense to see through, as thermal signatures are much more visible during thick fog than what can be seen with the naked eye or normal camera.

Ukrainians had also prepared powerful fortifications in and around Uspenivka. With Russians taking close to a month to capture the town of Novovasylivka, even having to deploy elite Spetsnaz special forces units to break the stagnation, Ukrainians had ample time to build up their defenses in the next settlement over.

On top of that, the Russian attack was complicated by a small river branch creating extremely marshy terrain between Uspenivka and Novovasylivka, creating a single crossing point, on which Ukrainians could focus their fire, which Ukrainians heavily patrolled with their new and improved reconnaissance drones.

Combat footage from the area reveals that during a standard drone patrol, a Ukrainian drone spotted a small group of Russian soldiers moving towards a barn in Uspenivka. Curious, Ukrainians held off on conducting a strike, and waited to see if more would show up, eventually counting over 70 Russian soldiers all gathered together in the hangar.

Meanwhile, Russians waited until the fog got thicker before moving in a massive column toward Ukrainian positions, unaware of the fact that they had long been detected. As the Ukrainians had held off on calling in a strike, Ukrainian artillery crews were able to prepare a full barrage on the single bridge that Russians could use to cross, as soon as they started their attack. Ukrainians rained down Hell on the still bunched-up Russian soldiers, who did not disperse until it was far too late.

Ukrainians fired both conventional and cluster munitions on the Russian soldiers, tearing through the Russian infantry wave. After the large mass was dealt with, Ukrainians continued hunting down the remaining Russian soldiers with FPV kamikaze drones and drone-dropped grenades, making sure that none were left alive to continue the attack.

In the end, Russians had been overconfident that the fog would completely conceal their movements, while Ukrainians went out of their way to adjust to the Russian tactic. This overconfidence led to the complete destruction of the Russian assault group by Ukrainian precision fire and cluster munitions.

The continued failure of Russian forces to make any significant or rapid gains in this sector, is already seeing significant consequences for the Russian offensive effort on Pokrovsk overall, as they continue pouring in their reserves.

With Ukrainians making sure that there were no Russian soldiers left alive to continue the attack, Russians will have to wait again till the weather conceals their movements, further delaying the Russian momentum while they are so desperate for a breakthrough.


11,296 posted on 02/03/2025 3:26:22 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 11295 | View Replies]

This is the reason

If earlier in the Kupyansk direction the enemy tried to launch assaults with columns of armored vehicles, now such assaults are carried out almost exclusively by infantry.

“The previous two assaults by armored vehicles were repelled, the equipment was destroyed, and the infantry, who managed to dismount, was destroyed during the movement to the landing by FPV drones, drops from the “Mavic”. Therefore, now the enemy does not do this, sometimes uses light automotive equipment,” Nadiya Zamryga said. The servicewoman also said that the Russians use ATVs or cars for assaults to be less noticeable — but our soldiers destroy them anyway.

There has been no change in Russian tactics in the Kupyansk direction so far. “These are also small groups of infantry trying to move towards the positions of the Armed Forces of Ukraine day and night,” says Nadiya Zamryga. At the same time, the enemy is drawing up reserves in manpower, but this is due to significant losses in manpower and to the enemy.

https://armyinform.com.ua/2025/02/02/yidut-na-vsomu-shho-ruhayetsya-u-zsu-rozpovily-pro-speczyfiku-rosijskyh-atak-na-kupyanskomu-napryamku/

11,297 posted on 02/03/2025 3:44:29 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 11295 | View Replies]

To: FtrPilot; marcusmaximus

Big hits on Russian oil and gas facilities overnight.

Kyiv Independent reports:

“Ukrainian drones attacked an oil refinery in Volgograd and a gas processing plant in Astrakhan in Russia overnight on Feb. 3, a source in the Security Service of Ukraine (SBU) told the Kyiv Independent.

The drones, operated by the SBU and the Special Operations Forces, targeted the flare farm, two primary processing units, and two technological units at the Volgograd oil refinery, owned by Lukoil, one of Russia’s largest oil producers, the source said.

The gas condensate processing complex at the Astrakhan Gas Processing Plant was also reportedly damaged. The facility has halted operations as the fire continues.

Both targeted facilities are said to be major fuel producers for the Russian military.

…”The Volgograd oil refinery processes almost 6% of all oil in Russia,” the source said…

…This is the fifth attack on Russian oil refineries and other facilities in 2025, the source said. Ukrainian drones previously hit the Lukoil-owned oil refinery in Volgograd on Jan. 31


11,298 posted on 02/03/2025 5:18:33 AM PST by BeauBo ( )
[ Post Reply | Private Reply | To 11286 | View Replies]

To: BeauBo
Zelensky says he is unaware of $200 bln US aid to Ukraine


11,299 posted on 02/03/2025 5:19:53 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11298 | View Replies]

To: JonPreston

Tucker Carlson сalls Zelenskyy ‘dictator’, accuses Ukrainians of wasting his money

11,300 posted on 02/03/2025 5:20:58 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11299 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 11,261-11,28011,281-11,30011,301-11,320 ... 18,761 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson