Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 11,181-11,20011,201-11,22011,221-11,240 ... 20,221-20,222 next last

🚨 REPORT: UKRAINE loses more troops in two months than the entire BRITISH ARMY has available.

pic.twitter.com/Q2CU5IfcEO— Legitimate Targets (@LegitTargets) January 30, 2025


11,201 posted on 01/31/2025 3:18:51 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11200 | View Replies]

To: AdmSmith

That number would seem low compared to loses, but of course 🍈 will disagree. Only Russian loses are due to traffic accidents 😎🤔


11,202 posted on 01/31/2025 4:24:21 AM PST by blitz128
[ Post Reply | Private Reply | To 11191 | View Replies]

To: PIF

Looks like 🍈 continues to suffer keyboard diarrhea or if you can’t dazzle them with brilliance baffle them with bullshit.

Out of 11000+ posts not one lol, but I can see “his” position. Invasion, murder, kidnapping, execution of POWs, kidnapping of children, “window accidents”, bombing and targeting of civilians…..WWPD


11,203 posted on 01/31/2025 4:34:58 AM PST by blitz128
[ Post Reply | Private Reply | To 11195 | View Replies]

To: blitz128

🍈 is quickly morphing into just another 🦠.


11,204 posted on 01/31/2025 5:10:00 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 11203 | View Replies]

To: blitz128

Only Russian loses are due to traffic accidents

Yes, traffic accidents are endemic where ever Russians are found. You’d think they never has any training. Worse, they have a habit of burning their vehicles when they have an accident with it - just look at the landscape in Ukraine - burned out Russian motorized carts, motorcycles, mopeds, & cars litter the roadsides.

I just hope that 🍈 is not driving or we may lose him soon, before he completes his full transformation into a 🦠, the horror!


11,205 posted on 01/31/2025 5:18:38 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 11202 | View Replies]

To: PIF

I think that transition happened around reply 500 lol


11,206 posted on 01/31/2025 5:19:20 AM PST by blitz128
[ Post Reply | Private Reply | To 11204 | View Replies]

To: PIF

FYI, Russian dashboard camera video is quite entertaining


11,207 posted on 01/31/2025 5:21:07 AM PST by blitz128
[ Post Reply | Private Reply | To 11205 | View Replies]

To: PIF

https://m.youtube.com/watch?v=haKdNPp6dOk

All is well


11,208 posted on 01/31/2025 5:28:01 AM PST by blitz128
[ Post Reply | Private Reply | To 11205 | View Replies]

To: blitz128

It is being used now as a UKR fund raising video 😂


11,209 posted on 01/31/2025 6:03:39 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 11208 | View Replies]

To: PIF

Coffin AA box more of 🍈’s GDP 😎😂🦆


11,210 posted on 01/31/2025 6:28:23 AM PST by blitz128
[ Post Reply | Private Reply | To 11209 | View Replies]

Tulsi is Donald Trump's appointment; she is AMERICA FIRST


11,211 posted on 01/31/2025 7:17:01 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11201 | View Replies]

To: PIF; Keith

Former US Congresswoman Tulsi Gabbard says there is no freedom or democracy in Zelensky's Ukraine.pic.twitter.com/8SEZUG5iCf— Hassan Mafi ‏ (@thatdayin1992) January 29, 2023


11,212 posted on 01/31/2025 7:25:28 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11211 | View Replies]

To: BeauBo

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Mass Arrests! Russian Soldiers Are Broken! ]

Today [ Jan 30, 8 pm ], there are a lot of interesting updates from the Pokrovsk direction.

Here, the Russian assault near Pokrovsk descends into chaos as poorly executed operations, inhumane treatment, and the sending of wounded soldiers on assaults led to devastating losses and ever-decreasing Russian morale.

With Russian commanders resorting to handcuffing their soldiers together to prevent desertions, underlying issues remain unsolved, and Russian soldiers become increasingly unwilling to throw away their lives.

The goal of the Russian forces in this area remains the same: to establish positions on the outskirts of Pokrovsk and the agglomerated settlements. The Russian offensive operation on the city’s western flank near Kotlyne and Udachne is stalling, with Ukrainians launching counterattacks to limit Russian progress.

By assaulting Pokrovsk directly, Russians hope to establish a foothold that would nullify their logistical issues, caused by a lack of infrastructure to accumulate supplies.

To achieve this, the Russian forces are utilizing their positions in the village of Pischane, launching assaults through the forests and tree lines that connect it to the agglomerated settlements on the outskirts of Pokrovsk.

The buildings and a nearby mine in Pischane, allowed the Russians to accumulate a large enough force to launch pure-infantry assaults through the narrow tree lines and forest patches to reach and initiate fighting for Zvirove.

Through these tactics, Russians are trying to utilize the main advantage of their close proximity to Ukrainian positions in Zvirove. Russians are trying to use the tree lines and small forests in the area to conceal their troop movements along this already short distance, allowing Russian forces to quickly reach Ukrainian positions while minimizing losses along the way.

However, Russian assaults are limited by a lake and a small river in the north, forcing them into a narrow funnel south of Zvirove, which Ukrainians have further reinforced with razor wire and landmines, forcing the Russian forces into casualty-intensive assaults.

As Ukrainians understood that Russians could only move through this narrow area, they unleashed a swarm of reconnaissance drones equipped with thermal and night vision cameras to monitor the tree lines and strike any Russian forces attempting to attack.

Combat footage from the area reveals how Ukrainians detected the movement of Russian forces with thermal cameras, almost immediately after they left their cover. This allowed the Ukrainians to accurately strike the Russian assault with conventional artillery and cluster rounds, inflicting tremendous losses and leaving no survivors.

In total, Russian commanders launched 4 waves of assaults along this tree line over the following 40 minutes, with complete disregard for the fact that Ukrainians kept destroying each wave they sent, forcing the Russian soldiers to climb over the deceased bodies of the previous waves.

Additional footage from the aftermath of the attack shows one of the surviving Russian soldiers isolated in a dugout, filming himself and stating that his commander refused to evacuate him and the other wounded, leading to him being the only one left alive. Ukrainians quickly detected this soldier, providing him with food and water and guiding him back to Ukrainian lines so he could surrender himself.

Russians also shared another video, showing more wounded soldiers being prepared to go on assault while walking on crutches. As instances of extreme neglect by Russian commanders grow, the morale of Russian soldiers is reaching new lows, creating extreme dissatisfaction and risking massive desertions.

Later footage shared by Russian soldiers in the Pokrovsk direction, shows how the commanders solved this issue by tying their soldiers together with handcuffs as they were transported to the front, fearing these men would desert while on their way to the front.

Besides the cruelty of such measures, Ukrainians also extensively target Russian transport vehicles moving to the front, meaning that if these trucks are hit, the Russian soldiers have a near-zero chance of escaping the burning wreck alive.

Overall, the mismanagement and poor treatment of their soldiers, combined with poorly executed assaults, are causing massive casualties among Russian forces.

Further continuation of such costly assaults will lead to deterioration of combat readiness of the remaining Russian forces, while the rapidly deteriorating morale is seeing Russian commanders implement increasingly distressing measures, to prevent mass desertions among Russian soldiers.


11,213 posted on 01/31/2025 7:39:07 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 11193 | View Replies]

To: BeauBo; boo

‼️🇪🇺🇷🇺 Following Denmark's permission to repair the #nordstream gas pipeline, the EU is now debating resetting purchases of #Russian gas - Financial Times

The EU debates restarting Russian gas purchases and removal of some sanctions as a form of peace deal with the Kremlin.… pic.twitter.com/C8bdxHq4Zr— Maimunka News (@MaimunkaNews) January 30, 2025

Looks like the war in #Ukraine is nearing an end and serious negotiations are taking place in the background.


11,214 posted on 01/31/2025 8:02:02 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11212 | View Replies]

To: SpeedyInTexas
Not one of these people supports Zelensky or the Ukraine war

Your miserable war is over

MAGA/MAHA is Ascending


11,215 posted on 01/31/2025 9:13:03 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11214 | View Replies]

To: blitz128

Ukranian army attacking women and children in Gorlovka.

That’s pure terrorism, nothing else. pic.twitter.com/IUTBOWNE8e— Lord Bebo (@MyLordBebo) January 31, 2025


11,216 posted on 01/31/2025 9:24:13 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11210 | View Replies]

To: PIF
On January 29, Ukraine attacked the Andreapol oil pumping station. Today Bloomberg writes that oil shipments from the port of Ust-Luga have supposedly been stopped!

https://bsky.app/profile/evgen-istrebin.bsky.social/post/3lgycrvzdsc2e

11,217 posted on 01/31/2025 9:31:52 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 11213 | View Replies]

Ukraine Strikes One of Russia’s Largest Oil Refineries, Disrupting Key Fuel Supply.

The refinery, owned by Lukoil and located in Volgograd’s Krasnoarmeysky district, has an annual processing capacity of 14.8 million tons of crude oil, making it the sixth-largest refinery in Russia. It produces gasoline, diesel fuel, fuel oil, and aviation fuel.
https://united24media.com/latest-news/ukraine-strikes-one-of-russias-largest-oil-refineries-disrupting-key-fuel-supply-5506


11,218 posted on 01/31/2025 9:36:49 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 11217 | View Replies]


11,219 posted on 01/31/2025 9:40:49 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 11218 | View Replies]

https://bsky.app/profile/maks23.bsky.social/post/3lh2cwlq3rc2q
11,220 posted on 01/31/2025 9:45:57 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 11219 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 11,181-11,20011,201-11,22011,221-11,240 ... 20,221-20,222 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson