Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 0putinsfolly; 0putinswar; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynow; anydaynowputinwins; anydaynowrussiawins; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; jonputinbot; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 11,041-11,06011,061-11,08011,081-11,100 ... 22,281-22,294 next last
MINSK, 27 January (BelTA) – As many as 86.82% of the voters cast their ballots in favor of Aleksandr Lukashenka during the latest presidential election in Belarus, BelTA learned from Chairman of the Central Election Commission (CEC) of Belarus Igor Karpenko in the information center.

Preliminary information about the number of votes for every candidate for the presidency of the Republic of Belarus:

Oleg Sergeyevich Gaidukevich – 2.02%;
Anna Anatolyevna Kanopatskaya – 1.86%;
Aleksandr Grigoryevich Lukashenka – 86.82%;
Sergei Aleksandrovich Syrankov – 3.21%;
Aleksandr Nikolayevich Khizhnyak – 1.74%;
None of the above – 3.60%.

https://www.belarus.by/en/press-center/news/lukashenko-wins-8682-of-vote-in-belarus-president-election_i_0000184634.html

The limit for Lukashenka was below 88% since

Presidential elections were held in Russia from 15 to 17 March 2024. It was the eighth presidential election in the country. The incumbent president Vladimir Putin won with 88.48% of the vote, the highest percentage in a presidential election in post-Soviet Russia, gaining a fifth term in what was widely viewed as a foregone conclusion. He was inaugurated on 7 May 2024.

https://en.wikipedia.org/wiki/2024_Russian_presidential_election

11,061 posted on 01/27/2025 1:23:42 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 11060 | View Replies]

To: marcusmaximus

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Massive Razor Wires! Piles of Russians Stack Up! ]

Today [ Jan 26, 8 pm ], there are a lot of interesting updates from the Pokrovsk direction.

Here, the Russian forces launched a bold push toward the outskirts of Pokrovsk, aiming to establish a crucial foothold for future operations.

However, with razor wire blocking their path and piles of Russian bodies scattered across the fields, the relentless assaults only feed the growing carnage in front of the fortified Ukrainian lines.

The primary objective of the Russian attacks is to secure a foothold on the outskirts of Pokrovsk to amass forces and equipment for future offensives. However, their advance on the western flank is hampered by stretched logistics, open fields, and limited infrastructure in villages, already devastated by fighting.

The few remaining structures in these villages are insufficient for assembling larger forces, restricting assault units to just 4 soldiers each. Meanwhile, units advancing across open fields remain under constant fire.

To improve the numerical strength of their assault units and stabilize their logistics for more powerful assaults, the Russian commanders decided to switch their focus to a direct assault on the southwestern outskirts of Pokrovsk.

By breaching the Ukrainian last line of defense in front of Pokrovsk, and establishing positions in the city’s southwestern outskirts and agglomerated settlements, the Russian forces could accumulate and station a larger number of forces and equipment for future assaults against the inner city.

The main target of the Russian assaults is the village of Zvirove, which, together with several other villages, form an urban agglomeration as a part of the city outskirts. For this effort, the Russian forces are trying to deploy as many mechanized assault units as possible across the open fields, deploying them now, since they will be mostly ineffective once the urban fighting starts.

The main advantage for Russian forces in this area is their logistical hub in Shevchenko, just two kilometers from Pokrovsk’s outskirts. Additionally, two hardened roads connect their positions to Zvirove and Pokrovsk, providing favorable conditions for their attacks.

However, if we look at the topographic map, we can see that the Ukrainians hold a significant advantage, as Pokrovsk sits at a higher elevation than Russian positions in Shevchenko and near the roads, enabling Ukrainian forces to maintain fire control over these routes.

Additionally, high-rise buildings in the city’s southern part provide excellent vantage points for observing Russian movements and deploying reconnaissance and strike drones.

Lastly, the city’s extensive infrastructure allows Ukrainian forces to concentrate troops and equipment, effectively countering Russian advances with all necessary weapon systems.

With this in mind, the Ukrainian forces positioned ATGM systems, including Javelins, to meet the Russian armored columns during their advance, utilizing their higher elevation and expanded field of view to effectively target and eliminate them.

To further increase the chances of a successful destruction of Russian armored assaults, the Ukrainians set up razor wire defenses across the fields and roads in front of Pokrovsk and Zvirove, to slow down the Russian vehicles and infantry for more effective targeting and destruction.

Combat footage from the area reveals the destruction of a Russian column in the area by Javelin anti-tank systems, which effectively struck the Russian tanks and armored vehicles while crossing the open fields. This led to severe losses among the Russian mechanized formations, as many of them were already destroyed on the approaches, and before they could breach a gap for the infantry to exploit.

This left only the surviving Russian foot soldiers to approach the razor wire defenses and cut them to open a gap. However, Ukrainians maintained constant surveillance of their defenses and concentrated their drones on the Russian breaches, creating absolute kill zones for Russian soldiers.

Overall, the Russian forces tried to intensify their direct assaults on the city of Pokrovsk to establish a foothold in the city and improve their logistical situation. However, the Ukrainians took advantage of their superior tactical positions, and utilized the heights to eliminate the advancing Russian forces with ATGMs, as well as in meticulously planned defenses and kill zones.

Ukrainian success at repulsing this large mechanized attack will force the Russians to rethink their plans for direct assaults on Pokrovsk, while the Ukrainians additionally reinforce their already powerful defenses.


11,062 posted on 01/27/2025 5:24:55 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 11055 | View Replies]

To: lodi90

11,063 posted on 01/27/2025 6:02:56 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11056 | View Replies]

To: BeauBo

🚨BREAKING: THE 155 MILLION DOLLAR PHOTO... Mitch McConnell got $89 million in kickbacks while Chuck Schumer had $66 million of our tax dollars to Ukraine laundered into his pocketbook, says top Ukrainian official.

What's Your Reaction? pic.twitter.com/WcbcGhoGED— MELANIA TRUMP - PARODY (@MelaniaTrumpo) January 26, 2025


11,064 posted on 01/27/2025 6:05:16 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11053 | View Replies]

To: BroJoeK

🚨 REPORT: Trump administration halts aid to Ukraine, other countries, "shocking" officials, with the order being sent by Sec. of State Marco Rubio - POLITICO— Eric Daugherty (@EricLDaugh) January 24, 2025


11,065 posted on 01/27/2025 6:08:02 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11064 | View Replies]

To: blitz128

When sh*t hits the fan

The head of the Ukrainian secret service, Kiril Budanov, said after a closed session of the Verkhovna Rada that if negotiations on the Ukrainian conflict do not begin by the summer, Ukraine will cease to exist.

And it would be, without Ukraine, finally… pic.twitter.com/A90dHtwaL3— SlavicFreeSpirit (@SlavFreeSpirit) January 27, 2025

The head of the Ukrainian secret service, Kiril Budanov, said after a closed session of the Verkhovna Rada that if negotiations on the Ukrainian conflict do not begin by the summer, Ukraine will cease to exist.

And it would be, without Ukraine, finally the beginning of a peaceful and calmer life, which would at least allow us to breathe better air in the European Union, without the Bandera aroma, without the fear of Bandera's people breaking our ribs in the home countries of the European Union!


11,066 posted on 01/27/2025 6:13:31 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11065 | View Replies]

To: AdmSmith

Kremlin snuff box, 01/26/24
https://t.me/s/kremlin_secrets

Lukashenko doubted that Russia would win the North Military District. And we give him “Oreshnik” for this?

The Belarusian president put forward his own version of resolving the Ukrainian crisis. This statement ( you can read it in full here [ https://t.me/ejdailyru/298154 ] ) caused conflicting reactions in Moscow.

“From the words of our Belarusian partner, it turns out that we will finish the Northern Military District without even completely liberating the Kherson and Zaporozhye regions. That is, he doubts the Victory of Russia [ https://t.me/bbbreaking/198682 ].

“And he repeats harmful theses that everything will end soon, talks about some kind of light at the end of the tunnel. What demotivates both our society and the military. It would be better if he took care of his problems, otherwise they could become very serious,” a source in the Kremlin, who is one of the hawks, is outraged.

Indeed, Lukashenko’s words largely coincide with the rumors about the imminent completion of the Northern Military District that are circulating at the front [ https://t.me/kremlin_secrets/5198 ]. And, according to many officers, they have a bad effect on the mood among the military.

At the same time, our interlocutor in the Ministry of Defense otherwise interprets Lukashenko’s statement:

“Perhaps he passes the West a signal from Vladimir Vladimirovich. But I don’t know for sure. In general, I’m getting confused already, now there have become a lot of strange things, they say a lot of everything.”

Against the background of such statements, the confirmation of our recent insider also looks strange. We wrote that Lukashenko asked Vladimir Putin to urgently send the Oreshnik complex to Belarus [ https://t.me/kremlin_secrets/5187 ].

A week passed, and Alexander Grigoryevich joyfully declares: these missiles will be in his country from day to day [ https://t.me/bbbreaking/198694 ].

The Ministry of Defense confirmed this information to us. We are honest, we are surprised. Lukashenko not only says incomprehensible things and doubts our victory.

Many soldiers continue to warn: you can not transfer such a powerful weapon as a “hazel”, not the most reliable ally. But they did not listen to these warnings [ https://t.me/kremlin_secrets/5000 ].


11,067 posted on 01/27/2025 7:02:03 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 11061 | View Replies]

To: AdmSmith

Kremlin snuff box. 01/27/24
https://t.me/s/kremlin_secrets

Why is Putin going to the regions?

This week, Vladimir Putin will visit several regions of our country and will deal with the development of unmanned aviation, the Russia 1 television channel said [https://t.me/kremlin_secrets/4980 ].

We asked what became the real reason for Putin’s trip to the regions.

“Lukashenko really wanted Vladimir Vladimirovich to arrive in Minsk and demonstrate support. But now it is important for us to maintain stability in the regions. Governors have accumulated questions [ https://t.me/kremlin_secrets/4980 ], some do not have time for our requirements. We need communication,” a source close to Sergey Kiriyenko said.

First of all, according to him, the issues of stimulating the conclusion of contracts from the Ministry of Defense, as well as issues of increasing the birth rate, will not be discussed [ https://t.me/kremlin_secrets/5203 ]. Surprisingly, of course, that the president has to deal with such issues.


11,068 posted on 01/27/2025 7:04:58 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 11061 | View Replies]

To: AdmSmith

They’re really isn’t a lot to go bankrupt in Russia, though. The lack of economic activity outside of business hubs is apparent when you visit. Russia is really still just a big and empty place. Stuck decades in the past due to the corruption and mismanagement of Putin’s regime.


11,069 posted on 01/27/2025 8:21:08 AM PST by lodi90
[ Post Reply | Private Reply | To 11060 | View Replies]

oofa??

🚨REPORT: BBC has confirmed that 90 THOUSAND Russian troops have DIED in the Ukraine War.


UKRAINE has suffered nearly 1 MILLION losses.

pic.twitter.com/fUB5SiuSHm— Legitimate Targets (@LegitTargets) January 27, 2025


11,070 posted on 01/27/2025 10:19:06 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11066 | View Replies]

To: BeauBo

🍈 sure is a racist😎


11,071 posted on 01/27/2025 12:25:14 PM PST by blitz128
[ Post Reply | Private Reply | To 11053 | View Replies]

To: blitz128

Sure it is not 1,000,000,000😎


11,072 posted on 01/27/2025 12:26:40 PM PST by blitz128
[ Post Reply | Private Reply | To 11071 | View Replies]

To: blitz128

I would take issue with those numbers. Its well known that a Russian troop is highly trained and can take out any martial arts expert with ease. When it comes to the annual tank face off, the Russian crews always finish 1st, 2nd & 3rd.

So with those facts in mind, we can only conclude that maybe 9 Russians have perished during the entire Ukrainian invasion, and all of those were from traffic accidents, due to unruly Ukrainians who have not even learned how to drive a car properly.

We have seen streams of reports how Ukrainian troops have thrown themselves at the invincible Russian lines in meat wave after human meat wave. Fortunately, after suffering over one billion dead Ukrainian troops, the Russians are driving them back toward Poland, with maybe 15km to go before the Ukrainians are completely pushed out of this Russian province.

Now about those Poles ...


11,073 posted on 01/27/2025 12:41:05 PM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 11072 | View Replies]

Run for your lives, boys!!


11,074 posted on 01/27/2025 1:01:06 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11066 | View Replies]

To: blitz128

No, that’s next year’s Ruble to Dollar exchange rate.


11,075 posted on 01/27/2025 2:45:00 PM PST by Mr. Lucky
[ Post Reply | Private Reply | To 11072 | View Replies]

To: lodi90

11,076 posted on 01/27/2025 5:02:59 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11069 | View Replies]

Where are you guys? Only 25 posts in nearly two days, and I have half of them? It looks like The Trump has walked away from this Biden mess and instead has focused on our own border. #MAGA


11,077 posted on 01/28/2025 2:38:46 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11076 | View Replies]

Some say Biden also tried to end Trump, yet his war effort was supported by the Low IQ among us

‼️ Biden Administration Attempted to End Putin Once and For All — Tucker Carlson

▪️ In an interview with journalist Matt Taibbi, Carlson claimed that the extremists in Biden’s circle were willing to take any steps to escalate the conflict between the U.S. and Russia.

▪️ He… pic.twitter.com/FOG9WBLefq— Zlatti71 (@Zlatti_71) January 28, 2025


11,078 posted on 01/28/2025 2:59:38 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11077 | View Replies]

To: blitz128

As I predicted, the Mexican cartels are already planting IEDs along US highways - confined to Shasta county CA for now.


11,079 posted on 01/28/2025 4:26:26 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 11072 | View Replies]

To: Mr. Lucky

Ooh 🍈 can count spamming this thread with his diarrhea of replies obviously proves that the Russians are winning, winning the keyboard war lol😎

Meanwhile in the real world Russia continues to burn, Russian GDP continues to be blown up and Russians and Norks continue to die for “dear leader”

Maybe another 25 posts will change that 😂


11,080 posted on 01/28/2025 4:30:15 AM PST by blitz128
[ Post Reply | Private Reply | To 11075 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 11,041-11,06011,061-11,08011,081-11,100 ... 22,281-22,294 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson