Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 10,921-10,94010,941-10,96010,961-10,980 ... 18,841-18,845 next last
To: BeauBo

Man important lessons are being learned, and it is so much better to learn them and be able to make changes and crank up new factories while we are not in a war ourselves.

“This all also speaks to real issues that the U.S. military itself could be faced with in the future, especially high-end ones like a fight with China in the Pacific. If U.S. capacity to produce things like replacement barrels for M777s is insufficient to meet the needs of Ukraine’s armed forces, it is hard to see how it could respond to far greater demands from American forces during a major conflict.

Lessons being learned from the conflict in Ukraine, as well as current operations across the Middle East, have already been having significant impacts on thinking about how the U.S. military should structure its own arsenal, especially stockpiles of key munitions, and be prepared to replenish it going forward. American obligations to the Ukrainian military, as well as operational demands in the Middle East, have also prompted serious criticism about the adequacy of current stockpiles.”


10,941 posted on 01/22/2025 2:56:25 PM PST by ansel12 ((NATO warrior under Reagan, and RA under Nixon, bemoaning the pro-Russians from Vietnam to Ukraine.))
[ Post Reply | Private Reply | To 10922 | View Replies]

To: BeauBo
It’s over

for globalism, especially in the EU and it's glorious. Wars, social programs and incompetence has been a national suicide. I suppose I have you war cheerleaders to thank for this, so in that regard I tip my hat in your direction. Please, come dance and sing with us. Crumbcake and coffee is available for a modest fee.

10,942 posted on 01/22/2025 3:25:19 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10940 | View Replies]

To: ansel12

10,943 posted on 01/22/2025 5:07:48 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10941 | View Replies]

To: PIF
Russian Offensive Campaign Assessment, January 22, 2025

The Kremlin has launched an information operation that seeks to create the false impression that the Russian economy is performing well despite numerous continued indicators of macroeconomic distress. Russian President Vladimir Putin claimed during a meeting on economic issues on January 22 that 2024 was a “strong year” for the Russian economy.[1] Putin claimed that Russia has a manageable budget deficit of 1.7 percent and achieved a 26 percent increase in non-oil-and-gas revenue to 25.6 trillion rubles (approximately $257.9 billion) in 2024 and announced a retroactive 9.5 percent increase in insurance and military pensions to address rising Russian inflation. Bloomberg reported on January 21 that the Russian Finance Ministry released a report projecting economic strength and suggesting that Russian budget revenue in December 2024 reached a record high of over 4 trillion rubles (about $40 billion) — a 28 percent increase compared to December 2023 and the highest level recorded since 2011.[2] The data fails to account for Russia's unsustainable levels of defense spending, rampant inflation, a growing deficit and the erosion of Russia's sovereign wealth fund, however.[3] ISW continues to observe macroeconomic data that directly contradict the Kremlin's claims that the Russian economy is performing well. The Kremlin has recently adopted policies aimed at increasing defense spending all while Russian society faces labor shortages, broader demographic issues, declining savings, and increasing reliance on bailouts as the Russian economy faces rising interest rates, inflated salaries, and deteriorating production capacity.[4] These economic realities suggest that the Kremlin's efforts to posture economic strength are largely an information operation aimed at reassuring domestic audiences and posturing Russian strength abroad while masking the true challenges Russia's economy is facing, particularly heightened due to its war against Ukraine.

Russian milbloggers complained and expressed concern over recent claims that the Hayat Tahrir al Sham (HTS)-led interim government in Syria suspended Russian investment and financial involvement in the port of Tartus as Russia's long-term military presence in Syria remains unclear. A Kremlin-affiliated Russian milblogger claimed on January 22 that the Russian government, via a Russian military official based in Turkey, recently reached an unspecified agreement with HTS that appears to have included permission for Russian vessels to dock in the port of Tartus.[16] Marine Traffic, a shipping tracking website, shows that the Russian Sparta and Sparta II cargo ships are docked in the port of Tartus as of January 22, and these ships are likely supporting the Russian military's evacuation of military equipment from the port. The milblogger claimed that the Russian and HTS-led governments continue to negotiate about the future of Russia's presence at the Tartus and Khmeimim military bases and noted that it is unclear if any other third-party might be interested in using the port of Tartus in the future.[17] Other Russian milbloggers expressed confusion over the situation in Syria and accused unspecified actors of spreading rumors about Russia's supposed agreement with the HTS-led government.[18] Syrian Interim Defense Minister Marhaf Abu Qasra stated on January 22 that Russian and Syrian officials have not reached a final solution in the negotiations about future Russian military bases in Syria.[19]

Russia and Uzbekistan are deepening military cooperation. Russian Defense Minister Andrei Belousov met with Uzbek Defense Minister Shukhrat Halmukhamedov in Tashkent on January 22 and signed a joint Russian-Uzbekistan military cooperation plan for 2025 and a strategic military partnership plan for 2026-2030.[79] Belousov stated that the delegation also discussed bilateral military-technical cooperation and regional security issues and claimed that Russian-Uzbek cooperation has a significant impact on regional security in Central Asia. Belousov also met with Uzbek President Shavkat Mirziyoyev on January 22.[80]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-january-22-2025

10,944 posted on 01/23/2025 12:52:07 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10928 | View Replies]

1,340 i.e. more than 0.93 Russians and Norks/min. Artillery systems and vehicles and fuel tanks are both about 2 times the average. This, together with the low loss of tanks, suggests that the Russians reduced their attacks.


10,945 posted on 01/23/2025 1:31:13 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10929 | View Replies]

To: AdmSmith

Ukraine's Chief Army Psychologist was arrested Tuesday on charges of stealing $1 million.

He may also have cached in on bribes from rich men trying to dodge the draft, on mental grounds.

He bought apartment buildings, cars and a luxury house.https://t.co/U5xfz1ATOx— Alternative News (@AlternatNews) January 23, 2025

LINK

Ukraine has detained its army's chief psychiatrist for alleged "illegal enrichment" charges related to earnings of more than $1m (£813,000) accrued since the start of Russia's invasion in February 2022.

In a statement, the Security Service of Ukraine (SBU) said the man sat on a commission deciding whether individuals were fit for military service.

The SBU statement did not name him - however, a man called Oleh Druz was previously identified as the Ukrainian Armed Forces' chief psychiatrist.

The SBU said he owned three apartments in or near Kyiv, one in Odesa, two plots of land and several BMW luxury cars, and investigators searching his home also found $152,000 (£124,000) and €34,000 in cash.

10,946 posted on 01/23/2025 3:58:54 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10945 | View Replies]

Zelensky suggest Trump should take a part of Russia, to expand America.

pic.twitter.com/Aw5Q2DhzOG— Lord Bebo (@MyLordBebo) January 23, 2025


10,947 posted on 01/23/2025 4:21:42 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10946 | View Replies]

??


10,948 posted on 01/23/2025 4:24:19 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10947 | View Replies]

To: JonPreston

BREAKING:

🇺🇲🇺🇦 The US has massively halted arms shipments to Ukraine

The United States has withdrawn all applications for the transit of goods in the interests of Ukraine through Rzeszow, Constanta and Varna.

All shipments of weapons and military equipment to Ukraine have… pic.twitter.com/i99OslJ0Aa— Megatron (@Megatron_ron) January 22, 2025


10,949 posted on 01/23/2025 4:26:40 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10946 | View Replies]

To: JonPreston

BREAKING: Vladimir Putin is reportedly seeking to have Anthony Fauci EXTRADITED to Russia to face COVID-era ‘Crimes Against Humanity’ Charges as part of a Deal to end the War in Ukraine.

This is HUGE! pic.twitter.com/G8lhwbCbKr— Cillian (@CilComLFC) January 22, 2025


10,950 posted on 01/23/2025 4:28:03 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10949 | View Replies]

To: JonPreston

10,951 posted on 01/23/2025 4:31:01 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10948 | View Replies]

To: BeauBo

🍈 & his 🦠 friends are going wild this morning. Their superiors must be pushing hard, toward which end one cannot say.😎


10,952 posted on 01/23/2025 4:53:28 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10940 | View Replies]

To: BeauBo

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ No Stopping Now: Russians Lost Their 400km Radar! ]

Today [ Jan 22, 8 pm ], there is interesting news from the Russian Federation.

Here, Ukraine has intensified its strategic strike campaign with a massive series of precision drone attacks targeting critical Russian oil infrastructure, igniting massive fires that burnt for days, and showcasing their growing ability to hit deep behind enemy lines.

These strikes not only sabotage Russian war efforts by crippling ground- and air forces’ fuel supplies, but also deal a severe blow to its revenue from oil exports, making sustaining their war effort an increasingly difficult task for the Russians.

The 1st of these devastating strikes targeted the Lisinskaya oil depot near Voronezh. This attack is particularly significant because the depot stored fuel specifically for the Russian military. Local officials claimed they intercepted 10 Ukrainian drones, but at least 3 of them managed to evade Russian air defenses and directly hit multiple fuel storage tanks, setting off a raging fire that continues to burn days later.

Despite Russian efforts to shield the depot with security nets designed to prevent drone attacks, they broke through with several drones hitting the same target and bypassing this protection, causing widespread destruction. Reports indicate that Russian emergency services have struggled to contain the inferno, due to a lack of fire hydrants near the site, further amplifying the damage while attempting to use water trucks to douse the flames.

With the 2nd strike, Ukrainian drones hit an oil depot and a factory in Lyudinovo, Kaluga region. The targeted facility, part of the Kaluganefetprodukt network, serves as a key logistical hub for Russian forces operating in Ukraine. Ukrainian Special Operations Forces, coordinating with drone units, again managed to inflict severe damage despite Russian anti-drone defenses.

A direct hit on such a facility further depletes Russia’s ability to sustain its frontline units. Fuel depots like these are crucial for keeping supply lines running, and as Ukraine continues to strike them, Russian forces will face increasing difficulties in maintaining their high-tempo attacks, as these logistical hubs cease to function without fuel storage capabilities.

The 3rd high-profile strike happened in the Tula region, where a large oil depot housing 58 fuel tanks was hit. Footage published by locals indicates that the resulting fire was so massive that it could be seen from kilometers away. The scale of destruction suggests a precision strike on key storage facilities, further draining Russia’s reserves.

The loss of such vital supply points means Russian mechanized units will face serious fuel shortages, directly impacting their ability to conduct large-scale offensives. As Ukraine pushes to degrade Russia’s logistical backbone, attacks like these significantly reduce the Russians’ operational tempo.

Beyond fuel depots, Ukrainian forces also successfully destroyed a Nebo-SVU multifunctional radar system in the Kherson region. This advanced radar, operated by the 49th Russian Army, was designed to detect and track aerial threats at long distances. Ukrainian drones executed a precise attack, rendering the system completely inoperable, as seen in the published images from the aftermath.

This strike is particularly significant because only 10 Nebo-SVU radars were ever produced, and several have already been destroyed in previous Ukrainian operations. With each lost radar, Russia’s ability to detect and intercept aerial threats weakens, allowing Ukraine to conduct even more devastating deep strikes with clear skies and a reduced risk of interception.

Overall, Ukraine’s latest wave of strikes underscores the growing effectiveness of its deep-strike capabilities. By systematically targeting Russia’s fuel infrastructure and air defense systems, Ukraine is achieving multiple strategic objectives. Namely, degrading Russian military operations due to fuel shortages, weakening Russia’s revenue streams as oil exports are a crucial source of military funding, and clearing the skies for future strikes while destroying irreplaceable radar systems.

As these strikes continue, Russia faces an increasingly difficult challenge in maintaining both its frontline assaults and its ability to finance the ongoing invasion, with Russia’s monthly fossil fuel export revenues dropping each month, reaching a low point in November last year, with a 21% fall compared to November 2023.


Nebo-SVU radar
https://en.wikipedia.org/wiki/Nebo-SVU


10,953 posted on 01/23/2025 4:54:20 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10940 | View Replies]

To: BeauBo
The Christo Files: Russia Exposed for Paying the Taliban to Attack US Soldiers in Afghanistan
22JAN2025

Did Russia pay the Taliban to attack American soldiers in Afghanistan? In this groundbreaking investigation, Christo Grozev reveals the truth behind Russia's secret bounty program, designed to destabilize coalition forces during the war in Afghanistan. He details the shocking findings, bringing you inside the investigation at each step.

Through exclusive data, leaked GRU emails, and new evidence found in a new documentary film, watch as he he pieces together how Russia's black ops unit 29155 orchestrated this operation, the couriers and spies involved, and the devastating toll on American and Afghan forces.

This exposé delves into:
The origins and motivations of the Russian bounty program.
The GRU black ops division responsible: Unit 29155.
The unlikely story of how the investigation was finally cracked, years after it first surfaced.
The real toll of the attacks funded by this program
And what is next for Russia and the Taliban.

https://www.youtube.com/watch?v=FKgCr0Sj83Y

17 min video

10,954 posted on 01/23/2025 6:26:08 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10937 | View Replies]

To: PIF

“🍈 & his 🦠 friends are going wild this morning”

Trump has rattled their cage.

They thought that Putin could smash and grab Ukraine, while Biden and Scholz were minding the store, but he failed, and is cornered.

Now they have to deal with Trump, and soon Scholz’s replacement. Russia is in a very precarious position, having already expended its fortune, military arsenal and energy weapon over Europe.

There is a big bill to be paid.


10,955 posted on 01/23/2025 6:48:08 AM PST by BeauBo
[ Post Reply | Private Reply | To 10952 | View Replies]

To: PIF; poof; poop
Has blintz, my Darwinian candidate, bailed on this dump too?

NATO CEO Rutte, "The frontline [Ukraine] is moving in the wrong direction."
"We have to change the trajectory of the war"...If Ukraine loses it will not be billions extra, it will be trillions extra.
👉NATO in a panic. Sunk Cost Fallacy kicking in. pic.twitter.com/vJgKlflLU1— Alex Christoforou (@AXChristoforou) January 23, 2025


10,956 posted on 01/23/2025 6:53:43 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10952 | View Replies]

Two Crackpots joined together by Ukraine and a hatred for America



10,957 posted on 01/23/2025 7:15:45 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10956 | View Replies]

To: AdmSmith

Kremlin snuff box, 01/23/24
https://t.me/s/kremlin_secrets

The Kremlin sent a strong signal to Trump, Moscow became worried

After Donald Trump’s statements [ https://t.me/kremlin_secrets/5200 ] about the prospects of ending the war in Ukraine, information about the mood in the Kremlin appeared in the Western press. According to Reuters [ see below ], Vladimir Putin believes that the main goals of the Northern Military District have already been achieved. In particular, control over the land corridor to Crimea and the weakening of the Armed Forces of Ukraine.

It is worth noting that the information caused a mixed reaction not only among the military, but also among the political elites.

“We first go to Kyiv, then to Kharkov, then we say that we want to take control of the DPR, LPR, Zaporozhye and Kherson regions, and now suddenly ‘the goals have been achieved.’ Then, it turns out, there is no need to fight further? Are our guys dying in vain? It seems to me that such statements are being spread by internal enemies. We need to liberate the Kursk region first, and then all our other territories,” says a source in the Ministry of Defense.

According to an interlocutor in the Kremlin’s political bloc, the article is essentially another signal to Trump about the Russian side’s readiness for negotiations.

“What is important is how we present the results of the Northern Military District to our society. A conditional settlement in the DPR is such a result, but a land corridor to Crimea, Mariupol, control over the Zaporozhye Nuclear Power Plant is another matter,” said an interlocutor close to Sergei Kiriyenko.

One of the hawks noted that he had not had the opportunity to communicate with the President for several weeks. The Kremlin considers the sentiments described in the Reuters article to be treacherous.

“Against the backdrop of Trump’s threats, this article looks humiliating. The author needs to be found and punished! No one will give up, the Kiev regime is about to be crushed,” the source said. At the same time, he emphasized the need to carry out mobilization as quickly as possible [ https://t.me/kremlin_secrets/5196 ].


Briefly, 01/23/24
https://t.me/brieflyru/31616

Reuters Exclusive: Putin becomes increasingly concerned about the state of the Russian economy, while Trump pushes for a deal on Ukraine. Part 1/2

▪️ President Vladimir Putin is increasingly concerned about Russia’s wartime economic dislocations even as Donald Trump pushes for an end to the conflict in Ukraine, 5 sources familiar with the situation told Reuters.

▪️ The Russian economy, driven by oil, gas and mineral exports, has grown strongly over the past 2 years despite multiple rounds of Western sanctions. However, domestic activity has become tense in recent months, due to labor shortages and high interest rates.

▪️ This has contributed to the view among some of the Russian elite that a negotiated settlement to the conflict is desirable, according to 2 sources familiar with Kremlin thinking.

▪️ Trump, who returned to office on Monday, promised to quickly resolve the conflict in Ukraine. This week he said sanctions and tariffs could be imposed on Russia, if Putin does not negotiate, adding that Russia faces “big problems” economically.

▪️ “Russia, of course, has an economic interest in a diplomatic end to the conflict,” former Russian Central Bank deputy chairman Oleg Vyugin said in an interview, citing the risk of growing economic imbalances as Moscow increases military and defense spending.

▪️ Vyugin was not 1 of the 5 sources who spoke on condition of anonymity, due to the sensitivity of the situation in Russia.

▪️ The degree of Putin’s concern about the state of the economy, as described by the interlocutors, and the influence of this factor on views on the military conflict within the Kremlin are being documented for the first time.

▪️ Last year, Russia achieved its most significant territorial gains, since the early days of the conflict, and now controls almost a fifth of Ukraine.

▪️ Putin believes that the main goals of the conflict have already been achieved, including control of the territory connecting mainland Russia with Crimea and weakening of Ukraine’s armed forces, said one of the sources familiar with the thinking in the Kremlin.

The Russian President also acknowledges that the standoff is putting a strain on the economy, the source said, citing “really big problems” such as the impact of high interest rates on non-military businesses and industry.


10,958 posted on 01/23/2025 11:21:06 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10954 | View Replies]

To: PIF; AdmSmith; BeauBo

It appears President Trump is so busy here at home, that he has not yet started moves on Ukraine/Russia. Letting the war continue for the moment is a lot harder on Putin’s situation than it is on Ukraine from all the info you are providing. Sending Fauci to Russia, now there is an idea!


10,959 posted on 01/23/2025 2:18:17 PM PST by gleeaikin (in Question authority as you provide links )
[ Post Reply | Private Reply | To 10958 | View Replies]

To: PIF; BeauBo; FtrPilot

Ryazan refinery getting pounded by Ukrainian drones right now.


10,960 posted on 01/23/2025 2:46:26 PM PST by marcusmaximus
[ Post Reply | Private Reply | To 10958 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 10,921-10,94010,941-10,96010,961-10,980 ... 18,841-18,845 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson