Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 10,801-10,82010,821-10,84010,841-10,860 ... 18,821-18,835 next last
To: speedy; neocon; poof; poop

BREAKING: Germany has officially stopped funding Ukraine.

Chancellor Olaf Scholz has REFUSED to approve a further €3 billion in military aid for Ukraine.

It’s over. pic.twitter.com/pVIQCzzF1r— Cillian (@CilComLFC) January 18, 2025


10,821 posted on 01/18/2025 4:23:45 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10814 | View Replies]

To: PIF

Yahoo reported earlier in 2024:

“Germany and Ukraine signed an agreement on long-term security cooperation and support, Ukraine’s Presidential Office announced on Feb. 16. President Volodymyr Zelensky signed the deal with German Chancellor Olaf Scholz during his visit to Germany.

This makes Germany the second country to finalize a bilateral security deal based on the pledge made by the Group of Seven (G7) countries last July (made - many have since followed, including all of the G-7). The U.K. signed a similar treaty with Ukraine in January (2024).

The treaty stipulates Germany’s “unwavering support” for Ukraine’s territorial integrity and promises to help the country defend itself against aggression.

It is valid for 10 years and defines priorities in international cooperation in the military, political, financial, and humanitarian spheres. The document also pledges more than 7 billion euros ($7.5 billion) in German defense support for Ukraine this year (2024), Zelensky’s office said.

“Germany will continue to support Ukraine in the face of the Russian war of aggression. Slava Ukraini,” Scholz said on social media upon signing the agreement.


10,822 posted on 01/18/2025 4:56:45 PM PST by BeauBo
[ Post Reply | Private Reply | To 10820 | View Replies]

To: PIF

Germany open to sending its troops to Ukraine (just like the old days - Putin did that)

Kyiv Independent reports:

“Germany may consider deploying its troops in a peacekeeping mission to monitor a potential ceasefire in Ukraine, German Defense Minister Boris Pistorius said on January 18...

...When asked if Germany was prepared to deploy troops to Ukraine in the event of a ceasefire agreement, Pistorius indicated that Berlin was open to the idea.

“We’re the largest NATO partner in Europe. We’ll obviously have a role to play,” Pistorius said in an interview with the German media outlet Suddeutsche Zeitung...

...The U.K. and France are reportedly already discussing the possibility of deploying French and British troops...

...Other German politicians have also commented on the issue of deploying Bundeswehr troops to Ukraine. Roderich Kiesewetter, a lawmaker from the opposition Christian Democratic Union (CDU), said on Jan. 3 that Berlin should not rule out the possibility.

Friedrich Merz, the opposition CDU/CSU alliance’s candidate for chancellor in the upcoming parliamentary elections, said on Dec. 28 that Germany could join a peacekeeping mission in Ukraine”


10,823 posted on 01/18/2025 5:01:16 PM PST by BeauBo
[ Post Reply | Private Reply | To 10820 | View Replies]

To: SpeedyInTexas

Russia’s Far Eastern oil fields clobbered by the latest sanctions package (even more sanctions are on the way next month, for the anniversary). Let the layoffs and freeze damage begin.

OilPrice.com reports:

The outgoing U.S. Administration on January 10 imposed the most severe sanctions on Russia’s oil yet.

Many of the vessels transporting Russia’s oil from the Arctic and Far East Pacific fields and production clusters to Asia have now been sanctioned.

India’s refiners have stopped doing business with the Russian tankers and companies sanctioned by the U.S., a source at the Indian government told Reuters on Monday.

“One week into the latest – and most aggressive yet – U.S. sanctions on Russian oil exports, the Asian buyers of Russian crude are scrambling for alternative supply, the price of oil has rallied, and analyses suggest that more than 1 million barrels per day (bpd) of Moscow’s export volumes could be severely constrained, at least in the short term.

The outgoing U.S. Administration on January 10 imposed the most severe sanctions on Russia’s oil yet, designating two major Russian oil companies, Gazprom Neft and Surgutneftegas, as well as 183 vessels, dozens of oil traders, oilfield service providers, insurance companies, and energy officials.

Many of the vessels, specialized tankers, and shuttle tankers transporting Russia’s oil from the Arctic and Far East Pacific fields and production clusters to Asia have now been sanctioned. This puts around 1.5 million bpd of Russia’s crude flows from its Pacific and Arctic ports at risk, according to a Bloomberg analysis of the tankers now designated by the U.S.

Most of the flows from the Sakhalin projects require special ice-class tankers—all of these have been sanctioned. The storage tankers and specialized vessels servicing shipments, storage, and loadings at Murmansk are also under sanctions now. The Gazprom Neft fields on the Yamal peninsula will also find it much harder to export crude—the company itself has been sanctioned, as have all its seven ice-class tankers handling shipments at and through the Arctic Gates terminal...

...The sanctions are already roiling the market. India and China are racing to procure alternative supply while studying the wider implications of the U.S. sanctions on Russian oil deliveries six months from now.

The sanctions caught a few million barrels of crude oil en route to India in a precarious situation. There is a wind-down period until February 27 for parties to complete dealings with now-sanctioned entities and vessels. Indian state-held refiners are targeting to settle the payments for Russian oil in half the time they have taken so far, as part of efforts to complete the deals before the seven-week wind-down period in the latest U.S. sanctions ends.

India’s refiners have stopped doing business with the Russian tankers and companies sanctioned by the U.S., a source at the Indian government told Reuters on Monday.”


10,824 posted on 01/18/2025 5:11:30 PM PST by BeauBo
[ Post Reply | Private Reply | To 10807 | View Replies]

To: PIF

“the crippled young veterans walking around”

By no means did I mean that as humor. That is an inescapable effect of this war. Many badly wounded will survive, and go home maimed and crippled. The numbers keep increasing. People will see them on the street, at their High School reunions, in the workplace, and each one has several degrees of separation with family, friends and acquaintances; who will hear their story.

People will notice. People will talk.


10,825 posted on 01/18/2025 5:18:43 PM PST by BeauBo
[ Post Reply | Private Reply | To 10820 | View Replies]

Russian Offensive Campaign Assessment, January 18, 2025

Ukrainian forces struck two Russian oil depots in Kaluga and Tula oblasts on the night of January 17 to 18. The Ukrainian General Staff reported on January 18 that Ukrainian Special Operation Forces (SSO) units and other Ukrainian forces struck an oil depot of the Kaluganeftprodukt joint-stock company (JSC) near Lyudinovo, Kaluga Oblast, causing a fire at the facility on the night of January 17 to 18.[1] Kaluga Oblast Governor Vladislav Shapsha claimed on January 17 and 18 that a drone strike caused a fire at an unspecified industrial enterprise in Lyudinovo, Kaluga Oblast, and later added that Russian forces downed seven drones over the region.[2] Russian sources posted footage purportedly showing the fire at the oil depot.[3] The Ukrainian General Staff also reported on January 18 that units of Ukraine's Main Military Intelligence Directorate (GUR) and other Ukrainian forces struck the state-owned “March 8” oil depot in Tula Oblast and noted that there were reports of a fire at the facility.[4] Tula Oblast Governor Dmitry Milyaev claimed on January 18 that drone debris struck an unspecified enterprise in Tula Oblast, causing a fuel tank to catch on fire.[5] Geolocated footage and other footage published by Russian milbloggers showed a fire at an oil depot near Didilovo, Tula Oblast.[6]

Ukrainian forces also struck a Russian air defense system and radars in occupied Ukraine on the night of January 17 to 18. The Ukrainian General Staff reported that Ukrainian forces struck a Russian “Nebo-SVU” long-range radar detection system in occupied Kherson Oblast; a Buk-M3 air defense system in occupied Donetsk Oblast; and a 9C32M radiolocation station of a S-300 air defense system in occupied Donetsk Oblast on January 18.[7] The Ukrainian General Staff reported that they are conducting battle damage assessments (BDA) of the strikes.

NATO officials are reportedly preparing for a joint NATO-Georgia exercise scheduled for March 2025.[21] The Georgian Ministry of Defense (MoD) reported on January 18 that the Commander of the NATO-Georgia Joint Training and Evaluation Center (JTEC) Colonel David Gagua met with NATO Joint Forces Training Center Commander Major General Bogdan Rycerski and discussed plans for the upcoming NATO-Georgia 2025 exercise. NATO reported on March 7, 2024, that the NATO-Georgia 2025 exercise is scheduled for March 2025 and that previous NATO-Georgia exercises focused on live and simulated training exercises and certification for NATO ally and partner countries’ military units.[22] Azerbaijani and Armenian sources reported on January 17 and 18 respectively that Azerbaijan will participate in the exercise and that Armenia will be an observer of the NATO-Georgia 2025 exercise.[23]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-january-18-2025

10,826 posted on 01/18/2025 11:15:28 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10790 | View Replies]

Russia used chemical weapons 434 times in December, Ukraine's General Staff says

Since the beginning of Russia's full-scale invasion, Ukraine's radiation, chemical, and biological intelligence units have been monitoring and recording the use of hazardous chemicals in attacks. The military has recorded 5,389 cases since February 2023.

Russian forces used K-51 and RG-VO munitions, anti-riot weapons that are prohibited for use in warfare, the General Staff said in their report. Russia has also used ammunition loaded with dangerous chemicals of “unspecified type.” The use of such weapons “grossly violates the rules of warfare,” the General Staff said. The report noted that chemical weapons attacks have “become systemic” since February 2023.

https://kyivindependent.com/russia-used-chemical-weapons-434-times-in-december-ukraines-general-staff-says/

10,827 posted on 01/18/2025 11:23:46 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10826 | View Replies]


10,828 posted on 01/19/2025 1:02:05 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10792 | View Replies]

To: gleeaikin; PIF; blitz128; FtrPilot; BeauBo; USA-FRANCE; canuck_conservative; marcusmaximus; ETCM
Кремлевская табакерка
Project “Kukushka”. Some women may start giving birth to children next year specifically for the state

According to several sources in the Kremlin and the government responsible for demographic issues, a pilot version of the project, codenamed “Kukushka”, may be launched in mid-2026. Let us briefly recall: the project involves the creation of Mother and Child Homes, where carefully selected women will become pregnant and give birth to children specifically for the state.

“This year, many measures aimed at increasing the birth rate are planned in Russia. After the birth rate is increased quantitatively, we can move on to qualitative aspects. We will select (of course, on a voluntary basis) healthy, promising and patriotic women. And they will give birth to future military personnel, politicians, and other representatives of the elite. Who knows, maybe they will even give birth to the future president of Russia,” said one of our interlocutors.

According to him, preparations for the introduction of “Kukushka” have already begun - within its framework, a number of regions have introduced payments (mainly 100 thousand rubles) for pregnant students and young mothers. In this way, a mechanism for selecting the most promising participants in the project is being developed. Payments to those who are selected may amount to up to a million rubles or even more. Now they are looking for a region to launch a pilot project. It is possible that it will be Moscow. To begin with, they want to select no more than 30-50 expectant mothers for the experiment. It is for this selection that residents of the capital have been tested for fertility (the ability to become pregnant, bear and give birth to children) for quite some time .

There are also discussions on a number of issues. Among them is who will impregnate the participants in the experiment. These could be their husbands and young men or specially selected men - participants and veterans of the SVO, as well as young political activists.

https://t.me/kremlin_secrets/5185

The Lebensborn programme: When Nazi Germany sought to create an Aryan elite

The Lebensborn programme, meaning spring or source of life, was one of the most secret and incredible projects of the regime in Nazi Germany. Its aim was to give birth to children who were seen as “perfect” in the eyes of the Nazis. These so-called Aryans – tall, blond and blue-eyed – were representatives of the “master race” that Adolf Hitler dreamed of.

https://www.france24.com/en/tv-shows/revisited/20241108-the-lebensborn-programme-when-nazi-germany-sought-to-create-an-aryan-elite

https://en.wikipedia.org/wiki/Lebensborn

10,829 posted on 01/19/2025 2:43:24 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10825 | View Replies]

Кукушка = https://en.wikipedia.org/wiki/Common_cuckoo


10,830 posted on 01/19/2025 2:49:38 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10829 | View Replies]

To: AdmSmith

“who will impregnate the participants in the experiment? These could be their husbands and young men or specially selected men - participants and veterans of the SVO, as well as young political activists.”

One big cultural difference between Hitler’s fascism and Putin’s fascism, is the huge amount of structural criminality/corruption under Putin.

Well, this is an opportunity for the Russian State to officially muscle into the prostitution racket. Perhaps a new subsidiary of Gazprom?


10,831 posted on 01/19/2025 4:18:35 AM PST by BeauBo
[ Post Reply | Private Reply | To 10829 | View Replies]

To: AdmSmith

As I have asked for some time, what does it mean to be called a nazi in these times. What was a nazi back then?

Nazi was a political party and a fascist/socialist ideology. There were and are plenty of people and parties that call themselves socialists and act as fascists. Are they all Nazis?

What most people think about is not their ideology, but their actions.
Control society, strict adherence to the party, control of the population and the media, pretty common stuff these days. So what made nazi germany and hitler the popular boogie man?
Hitler took it up a notch at least in modern times. History is full of dictators and those who committed atrocities. Nobody goes to protest and screams ….. is just like Attila the hun, or Caligula or for that matter Stalin or Mao who are more contemporary like hitler.
What did nazi germany do to elicit such reactions.
Beside the behaviors previously mentioned there was war, and invasion (still not uncommon) and doctrine of Lebensraum. so let’s get to the nitty gritty. Concentration camps, racial superiority(lebensborn program), medical experimentation, torture and murder of civilians(kristalnacht) and POWs, political murder (night of the long knives ), and there is the cult of personality and dictatorship. Just to mention a few characteristics of nazi germany.

So I will ask again, which country resembles nazi Germans and hitlers rule, Ukraine or Russia. I know how 🍈 will respond, that is no surprise


10,832 posted on 01/19/2025 4:24:57 AM PST by blitz128
[ Post Reply | Private Reply | To 10829 | View Replies]

To: BeauBo

“ One big cultural difference between Hitler’s fascism and Putin’s fascism, is the huge amount of structural criminality/corruption under Putin.”

I would argue there is little difference. Putin and RT and the 🍈 love to scream “Ukrainian nazis “ but when you examine Russia’s/putin’s actions and behaviors I see little difference, if there were a difference I would say Putin has hid it for sometime, but the covers have been pulled back and his true nature and desires have been exposed. There may not even be a dimes difference between hitler and Putin and their rule


10,833 posted on 01/19/2025 4:31:20 AM PST by blitz128
[ Post Reply | Private Reply | To 10831 | View Replies]

To: blitz128; BeauBo

Worth a separate post: Project “Kukushka”. Some women may start giving birth to children next year specifically for the state
https://freerepublic.com/focus/news/4291059/posts


10,834 posted on 01/19/2025 5:03:42 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10833 | View Replies]

To: BeauBo

Sorry you missed the inference: If some one is crippled that means they cannot walk around.


10,835 posted on 01/19/2025 5:05:51 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10825 | View Replies]

To: BeauBo

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Massive Russian Night Attack Turns Into a Massacre ]

Today [ Jan 18, 8 pm ], there is interesting news from the Kursk direction.

Here, the Russian military’s attempt to counter Ukraine’s advance towards Bolshoye Soldatskoye turned into a slaughter, due to poor planning and disastrous miscalculations.

Russian forces’ desperation to stem the Ukrainian bulge in the east has led them to rush in their soldiers in suicidal assaults, overlooking a crucial detail in choosing the wrong camouflage, which Ukrainians exploited with deadly efficiency.

Russian forces’ primary objective is to erode Ukraine’s foothold around Berdin, fearing it could become a springboard for further advances toward Bolshoye Soldatskoye. Holding this village is critical for Russia, as its loss would negate hard-fought gains west of Malaya Loknya, which were achieved at the cost of thousands of casualties.

If Ukraine secures and expands its position toward Bolshoye Soldatskoye, Russia will be forced to divert significant reinforcements, which are unavailable due to the mounting losses. With another Ukrainian bulge in the region deemed unacceptable, Russia has shifted its focus to Russkoye Porechnoye, a small but strategically vital village along a key supply route, which could serve as a staging ground for future Ukrainian offensives.

To counter Ukraine’s movements, Russian forces redeployed troops from the western part of the salient, partially sacrificing their offensive there. With these reinforcements, they launched a series of infantry assaults to overwhelm Ukrainian positions with sheer numbers, a tactical advantage the Russians still possess for the time being. The reliance on mass assaults in Russian doctrine, often with minimal coordination and outdated tactics, has been costly, but occasionally effective.

Mass infantry assaults require a lot of men, which means that last-minute changes are unfeasible on such a large scale. This led to the Russian approach suffering from an unexpected major vulnerability - the rapidly changing weather conditions in the Kursk region. One moment, the battlefield is covered in snow; the next, the ground is bare and muddy. Ukrainian forces exploited this unpredictability, turning Russia’s poor camouflage decisions into a death sentence.

The 1st wave of Russian attackers stormed Ukrainian positions on snow-covered terrain, without winter camouflage, making them easy targets for Ukrainian artillery, drones, and FPV kamikaze strikes. As footage from the battlefield shows, the result was fields littered with Russian corpses, struck down in open ground with little to zero cover.

Realizing their mistake, Russian commanders issued white camouflage gear to their troops for the next assault. However, the snow unexpectedly melted, leaving them dressed in all white, in stark contrast to the dark, muddy terrain. This made them even more visible, leading to another massacre as Ukrainian forces rained down artillery fire and drone strikes, decimating entire Russian assault groups.

Russian officers, desperate for progress, threw North Korean forces into battle in large formations of 20 to 100 soldiers, particularly in night assaults. The assumption was that attacking under the cover of darkness would improve their chances of breaking through Ukrainian defenses en masse.

However, Ukraine had recently received advanced ENVG-B night vision goggles, allowing its troops to spot enemy movements with extreme clarity, even in total darkness, fog, and snowstorms. This technology marked enemy silhouettes, giving Ukrainian forces a massive advantage in night combat. As a result, huge portions of the North Korean forces were destroyed before they even reached Ukrainian positions.

Another wave of North Korean soldiers was sent during the day, with geolocated footage revealing shocking images, like those seen during the Korean War 70 years ago, with large hordes attacking under heavy artillery shelling. Those who survived established some presence at Russkoye Porechnoye, but only at the cost of staggering losses. Once in the village, they faced relentless Ukrainian artillery and drone strikes, forcing many to either retreat or die in place.

Overall, the latest developments confirm that Ukraine’s Berdin operation has had both an immediate and strategic impact. Ukraine has successfully thinned enemy lines by forcing Russia to redirect troops from the western Kursk salient and relieving the Russian pressure on Malaya Loknya. As a result, Russia’s offensive on the western front has lost momentum, likely due to depleted reserves and logistical strain.

Despite Russians gaining some ground in Russkoye Porechnoye, the redirection of Russian forces means that Malaya Loknya will remain firmly under Ukrainian control, highlighting the failure of Russia’s costly mass infantry assaults to achieve any meaningful gains.


10,836 posted on 01/19/2025 5:10:55 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10831 | View Replies]

To: AdmSmith

If they could only get their “anti-falling debris “systems working


10,837 posted on 01/19/2025 5:17:08 AM PST by blitz128
[ Post Reply | Private Reply | To 10826 | View Replies]

To: blitz128
"If they could only get their “anti-falling debris “systems working".

She's too young to retire

10,838 posted on 01/19/2025 6:41:31 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10837 | View Replies]

To: pip; poop; Bingo
He's back, all you #NeverTrump freaks.

Enjoy the Suck!


10,839 posted on 01/19/2025 9:13:33 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10821 | View Replies]

To: AdmSmith

About your *PING* list, please remove the rancid, Ukie cheerleader, canuck_conservative. IT has been given the ZOT.


10,840 posted on 01/19/2025 9:16:51 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10829 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 10,801-10,82010,821-10,84010,841-10,860 ... 18,821-18,835 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson