Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 10,601-10,62010,621-10,64010,641-10,660 ... 20,261-20,262 next last

Zelenskyy:

In addition to the first captured soldiers from North Korea, there will undoubtedly be more. It’s only a matter of time before our troops manage to capture others. There should be no doubt left in the world that the Russian army is dependent on military assistance from North Korea.

Putin started three years ago with ultimatums to NATO and attempts to rewrite history, but now he cannot manage without military support from Pyongyang.

Ukraine is ready to hand over Kim Jong Un’s soldiers to him if he can organize their exchange for our warriors who are being held captive in Russia. For those North Korean soldiers who do not wish to return, there may be other options available. In particular, those who express a desire to bring peace closer by spreading the truth about this war in Korean will be given that opportunity.

https://x.com/ZelenskyyUa/status/1878502443077509588


10,621 posted on 01/13/2025 8:52:05 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10620 | View Replies]

To: AdmSmith

How the mighty have fallen - because of Putin.

Financial Times (UK) reports:

“Russian energy group Gazprom is considering plans to axe 1,600 jobs — a record number — as the company struggles with plummeting gas sales in Europe and sanctions against its oil arm in the wake of the Ukraine war.

Gazprom chief executive Alexei Miller was notified in a letter about plans to make cuts at the central office workforce in St Petersburg, from 4,100 to 2,500, about 40 per cent, according to Russian Telegram channels and later confirmed by an official company representative.

If implemented, it would mark the largest lay-off in the state-owned gas monopoly’s history as it faces unprecedented economic challenges following Russia’s full-scale invasion of Ukraine, which has ravaged its finances.

The energy group suffered its largest loss in at least 25 years — Rbs629bn ($6.9bn) — in 2023 as gas sales more than halved after explosions damaged the Nord Stream pipeline to Europe.

Revenues fell almost 30 per cent year on year to Rbs8.5tn, with gas sales dropping from Rbs8.4tn to Rbs4.1tn.

Analysts say the losses show how Gazprom, once a cash-rich “national champion” that used its hold over Europe’s energy supply as a geopolitical weapon, has failed to adapt to the crash in sales in the EU market.

European countries have had greater success than expected in finding alternative sources of gas.”


10,622 posted on 01/13/2025 3:45:58 PM PST by BeauBo
[ Post Reply | Private Reply | To 10621 | View Replies]

To: PIF; ETCM; AdmSmith

Previously, Russia’s oil exports from the Far East (ESPO grade), have not borne the brunt of sanctions. But the latest big package seems to be making a bit of a train wreck for them there.

Kyiv Independent reports:

“Three tankers carrying over 2 million barrels of Russian crude oil are floating off China’s coast after they were hit by fresh U.S. sanctions last week, Bloomberg reported on Jan. 13.

The vessels are allegedly part of the so-called “shadow fleet,” a group of tankers routinely used to evade sanctions targeting Russia’s oil trade.

This development follows the U.S. and U.K.’s most extensive sanctions on Russia’s oil sector, announced on Jan. 10. The measures target over 180 vessels in the shadow fleet, along with Russian oil companies and energy officials.

The Huihai Pacific, Mermar, and Olia, each carrying Eastern Siberia–Pacific Ocean (ESPO) crude from Russia’s Kozmino port, have diverted from their planned ports in China. The Huihai Pacific, initially headed for Dongjiakou in Shandong province, is now offshore, while the Mermar and Olia, bound for Yantai, are sitting in the Yellow Sea.

Reuters reported on Jan. 8 that China’s Shandong Port Group had prohibited U.S.-sanctioned tankers from accessing its ports in the eastern Chinese province.”


10,623 posted on 01/13/2025 3:55:16 PM PST by BeauBo
[ Post Reply | Private Reply | To 10616 | View Replies]

To: FtrPilot

Potential drop in the oil price cap for Russia under discussion. Russia sinks or swims, on the price of oil.

Kyiv Independent reports:

“Sweden, Denmark, Finland, Latvia, Lithuania, and Estonia have urged the European Commission to further decrease the $60 per barrel price cap on Russian oil set by the G7, Reuters reported on Jan. 13, citing their joint letter seen by the news agency.

The countries argue that a lower cap would further restrict Russia’s ability to finance its war against Ukraine while avoiding significant disruptions to global oil markets.

Under current terms, Western companies can insure and transport Russian oil only if sold below the cap. In their letter to the European Commission, the six nations reportedly emphasized the need to “further increase the impact of our sanctions by lowering the G7 oil price cap.”

The G7 initially implemented the cap to reduce Moscow’s oil revenues while maintaining stability in global markets. With forecasts of a global oil surplus in 2025 and softening prices, the G7 may consider more stringent measures.

Sanctions and Ukrainian drone strikes have already disrupted Russia’s oil production, with refineries in Tuapse, Ilyich, and Novoshakhtinsk reducing or halting operations. These pressures have forced Russia’s energy sector to sell oil at a discount and operate under high interest rates, further straining its capacity.”


10,624 posted on 01/13/2025 4:45:48 PM PST by BeauBo
[ Post Reply | Private Reply | To 10597 | View Replies]

To: AdmSmith; FtrPilot

Shut down Russian oil and gas revenues, then lets talk about ending the war.

Kyiv Independent reports:

“Ukraine this weekend attempted a drone attack on a compressor station in southwest Russia which is part of the infrastructure of the TurkStream gas pipeline—the last remaining route for Russian (pipeline) gas flows to Europe, Russia’s Defense Ministry said.

TurkStream is a pipeline connecting southern Russia to Turkey under the Black Sea and then delivering gas from Turkey to Europe. Hungary is the EU customer that receives Russian gas via TurkStream.

The Russian Defense Ministry said that Ukraine had sent nine drones to hit the Russkaya compressor station in the southwestern Russian region of Krasnodar with the aim of halting gas deliveries to European countries.

All drones have been shot down, Russia said...

...As a result of falling fragments of one shot-down drone, the building and equipment of a gas metering station at the compressor sustained minor damage... the Defense Ministry added...

...TurkStream remains the last gas route of Russia’s natural gas to south and southeast Europe via Turkey...

...Hungary will continue to receive Russian gas via the TurkStream gas pipeline via Turkey and the Balkans, while Austria and Slovakia have arranged to have natural gas from other sources supplied.”


10,625 posted on 01/13/2025 5:03:04 PM PST by BeauBo
[ Post Reply | Private Reply | To 10593 | View Replies]

To: PIF

Forbes Reports:

For The First Time Since 2022, Ukraine May Have A Tank Advantage Over Russia

“For the first time in Russia’s 35-month wider war on Ukraine, the Ukrainians may have a tank advantage over the Russians. But only only along certain stretches of the 800-mile front line.

“Our (Russian) tanks can only operate from covered positions,” one Russian blogger complained in a long missive translated by Estonian analyst WarTranslated.

Reduced to firing from camouflaged positions miles behind the front line, Russian tanks are essentially inaccurate howitzers—and not the assault-leading combat vehicles their designers intended.

By contrast, Ukrainian tanks operate “more freely,” the blogger claimed.

It all comes down to drones...

...Anywhere along the front line where the Ukrainians have managed to deploy two company-sized drone groups, each with a few dozen operators, Russian tanks “simply don’t reach the line for launching an attack,” according to the blogger. They get droned miles behind the line of contact.

Ukrainian tanks enjoy safer air space, the blogger claimed. “Our drone operations are much weaker” owing to intensive Ukrainian radio jamming and poor quality control in drone manufacturing overseen by corrupt Kremlin bureaucrats.

So Ukrainian tanks can roll right up to the line of contact to directly engage Russian forces with their cannons and machine guns...

...The Ukrainians’ purported tank advantage as the wider war grinds toward its fourth year represents a reversal since 2022. Back then, Ukrainian brigades “rarely used direct fire with tanks” owing to Russia’s huge advantage in artillery and air power...

...The exception to this alleged new dynamic is in Kursk Oblast in western Russia... The Kremlin has supplied its regiments and brigades in Kursk with the best fiber-optic drones, which are controlled via signals traveling through thin cables—and can’t be jammed by traditional means...

...But the Kremlin only supplies the new drones to “priority sectors” including Kursk, the blogger explained. That leaves units in other sectors to make do with drones that often don’t work—and when they do work, are promptly grounded by Ukrainian jamming.”


10,626 posted on 01/13/2025 6:49:23 PM PST by BeauBo
[ Post Reply | Private Reply | To 10617 | View Replies]

To: gleeaikin

Russian Offensive Campaign Assessment, January 13, 2025

South Korea’s National Intelligence Service (NIS) reportedly announced that North Korean casualties in Kursk Oblast total roughly 3,000 killed and wounded. The NIS reportedly announced at a closed-door meeting on January 13 that roughly 300 North Koreans were killed in action (KIA) and roughly 2,700 wounded in action (WIA) in Russia.[66] The NIS reportedly attributed the high casualty rate to the way Russian forces utilize North Korean forces and conduct assaults without fire support, which coheres with ISW’s previous assessments and observations about North Korean tactics and communication issues with Russian forces.[67]

Russian authorities are reportedly walking back a promise to allocate federal budget funds to protect certain deep rear areas from Ukrainian strikes. Russian news organization Vedomosti reported on January 13, citing its sources close to the Russian Ministry of Transport, that Russian authorities will not fund anti-drone measures from the federal budget for Category 1 airports within Russia, including airports in Moscow, St. Petersburg, Sochi, Kazan, Omsk, Chelyabinsk, Krasnoyarsk, Yekaterinburg, and Novosibirsk.[68] Vedomosti reported in September 2024 citing sources familiar with the matter that Russian authorities planned to allocate over 11 billion rubles (about $107 million) to equip 31 major Russian airports with anti-drone measures by 2028 as part of a national effort to develop infrastructure and security regarding drone usage.[69] ISW has recently assessed that Russia is struggling with the increasingly high costs of maintaining its war effort against Ukraine, and reducing funding for air defenses to protect areas far from the battlefield may be part of a Kremlin effort to limit some of these costs.[70]

Russian authorities continue increasing social service benefits to Russian veterans of the war in Ukraine likely as part of efforts to increase military recruitment. The Russian Government announced on January 13 that it began allocating grants on January 1 of up to seven million rubles (about $68,126) to Russian veterans to start their own agricultural and livestock enterprises.[71]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-january-13-2025


10,627 posted on 01/14/2025 1:10:26 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10612 | View Replies]


10,628 posted on 01/14/2025 1:12:18 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10614 | View Replies]

To: BeauBo; PIF
Кремлевская табакерка

14JAN2025 The enemies who were thinking about an assassination attempt on Putin have become more active and want to end the SVO [war in Ukraine] as soon as possible .

We wrote : some representatives of the Russian elite, who after the use of “Oreshnik” and the aggravation of our relations with NATO were afraid of a major war with the West, suspected of intending to organize an assassination attempt on Vladimir Putin. Thank God (our publications also influenced the situation, which we are very happy about), Russia's internal enemies have abandoned the worst-case scenario for now. But they can still return to their criminal plans, according to sources in the Kremlin and the FSB (we should note that the president currently has no concerns about these enemies , which is why they have not yet been brought to justice. This fact upsets Vladimir Vladimirovich's security).

It is noteworthy that Margarita Simonyan is suspected of having ties to internal ill-wishers. The reason is the journalist's statement that the military conflict in Ukraine may stop along the current front line.

“I don't know who advised Margo to say this. Certainly not Vladimir Vladimirovich. The President has never said anything about us stopping at the current front line. On the contrary, he sets quite realistic goals within the framework of the SVO. In particular, he expects us to liberate the Kursk region by the summer, and the entire territory of the DPR by the end of the year. And here is such a strange signal to the West: like, we are ready to stop, we will not take Odessa, and so on. We will figure out what happened and why Russia's internal enemies have become so active,” a source close to Putin, who is considered a hawk, told us.

The channel's interlocutor does not rule out the possibility that “someone in the Kremlin or business circles, who passionately desires the end of the SVO, and not our Victory, used Margarita in the dark.” But he does not relieve the journalist of responsibility for making such loud statements without personally coordinating them with Vladimir Vladimirovich.

“The SVO will go on as long as it needs to, and we will stop when it is necessary. Trust us, don't trust the assumptions of any journalists,” another source in the Kremlin said on this matter.

We should note: one of the interlocutors in the AP suggested that Putin could end the SVO and stop along the current front line “if Trump puts a lot of pressure on him.” But a number of hawks asked us not to worry : pressure from the new American president on Vladimir Vladimirovich is “impossible by definition.”

https://t.me/kremlin_secrets/5164

10,629 posted on 01/14/2025 1:25:10 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10626 | View Replies]

To: AdmSmith
American foreign policy, a scam built on corruption

Is American foreign policy primarily driven by corruption, contradicting its professed values of democracy and good governance? Critics argue that Washington’s policymakers, regardless of party affiliation, have steered the country into a series of disastrous wars—Afghanistan, Iraq, Syria, Libya, and Ukraine—earning widespread criticism for their “utterly irrational” decisions.

While America’s active role in supporting Israel’s actions in Gaza finds favor with many globally, some view it as a political maneuver by President Joe Biden. Despite Washington’s pressure on Israel for a ceasefire, seen as crucial to prevent aiding terrorist groups in Gaza, critics remain skeptical of the political motivations behind this stance.

Over the past two decades, major US foreign policy objectives have faltered. Afghanistan saw the Taliban’s resurgence after a lengthy US occupation, while Iraq became reliant on Iran post-Saddam Hussein. Efforts to oust Syria’s President Bashar al-Assad failed, leading to prolonged civil strife. Libya descended into a chaotic civil war following a US-led NATO intervention that ousted Muammar Gaddafi. Moreover, Russia’s 2023 assault on Ukraine came after the US clandestinely disrupted a peace agreement between the two nations in 2022.

The consistent presence of certain figures like Joe Biden, Victoria Nuland, Jake Sullivan, Chuck Schumer, Mitch McConnell, and Hillary Clinton in the echelons of US foreign policy leadership highlights a puzzling continuity amidst these failures.

10,630 posted on 01/14/2025 4:00:14 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10629 | View Replies]

To: AdmSmith

But a number of hawks asked us not to worry: pressure from the new American President on Vladimir Vladimirovich is “impossible by definition.”

Trump will be please to learn that. It will save a lot of time toward ending the war. Trump can now safely call B-1s & B-52s to carpet bomb Russian positions.


10,631 posted on 01/14/2025 4:02:08 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10629 | View Replies]

To: BeauBo

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Sides Switched. Confused North Koreans Attack Russians & Force Them to Retreat ]

Today [ Jan 13, 8 pm ], there are a lot of interesting updates from the Kursk direction.

Here, a Ukrainian precision strike on a critical Russian command post unleashed chaos within the enemy ranks, leaving Russian forces leaderless and disoriented.

Amid the turmoil, with no command and coordination structure, North Koreans attacked Russian forces, causing them to retreat from their positions, and opening the gates for the Ukrainian tank assaults.

The goal of the Ukrainian precision strikes is the elimination of Russian commanders and force concentrations. As Russians attempt to undermine the Ukrainian offensive northeast of Sudzha by assaulting it in the flanks, taking out the Russian command structure would completely collapse the Russian effort, causing chaos and disorganization to break out amongst the Russian ranks.

However, to conduct the strikes, Ukrainians first had to collect intelligence about the location of Russian command posts and force accumulations. Over the months, Ukrainians extracted information from unsecured Russian radio communications by simply switching to their frequencies.

All of this, combined with intel provided by Ukrainian Military Intelligence agents and informants within Russia, together with information from Russian prisoners of war, gave them a clear picture of the location of Russian command posts and force accumulations.

Subsequently, the Ukrainian forces conducted a HIMARS strike that successfully struck a command post of the Russian 810th Naval Infantry Brigade in the town of Belaya to the southeast of Sudzha.

The exact death toll of Russian soldiers and officers is as of yet unknown. Still, as all Russian assaults south of Sudzha were coordinated from this command post in Sudzha, Ukrainians will have effectively disrupted the Russian command structure with this strike.

As the Russian command structure is incredibly centralized, junior officers have little to take the initiative into their own hands. This meant that a direct strike on a Russian command post forced the temporary halt of all combat operations, and disruptions till new officers were able to take their place.

This allowed Ukrainian forces to retake the initiative and launch an attack to eliminate the Russian holdouts in the southern part of Makhnovka once and for all.

Ukrainians initiated the assault with intense artillery fire and FPV drone strikes against Russian positions, forcing most Russian soldiers to run for shelter. Ukrainians also deployed sappers to the village, who removed barbed wire and anti-tank mines from streets in Makhnovka to clear the way for armored assault columns.

This allowed Ukrainian tanks to enter the narrow streets, being escorted by foot soldiers for cover, as it provided direct fire on Russian positions. The remaining Russian forces in basements that could not be eliminated directly, were then subsequently finished off by FPV drone strikes. Losses of positions within Makhnovka and the loss of Russian momentum were not the only consequences of the Ukrainian precision strike on the Russian command post in Belaya.

As you know, North Korean soldiers were previously integrated into Russian units in this area. However, the collapse of a cohesive command structure caused confusion between North Koreans and Russians, further exacerbated by their language barrier.

A Russian soldier published a video where he explained how, in the confusion, North Korean soldiers opened fire on Russians in the friendly fire incident, believing them to be Ukrainians.

To make it worse, the language barrier prevented the Russians and North Koreans from halting the incident, which forced them to engage in a brutal firefight with each other. In the end, the Russian soldier reported that he was pulling back and withdrawing with the main force after the incident, since it became impossible to conduct further combat operations under their current circumstances.

Overall, the Ukrainians inflicted a heavy blow on the Russian command structure with a precise HIMARS strike on their command post in the deep rear, causing a complete collapse of Russian command and disorganization among their troops, which allowed the Ukrainians to retake the initiative and attack.

By continuing precision strikes on command posts and force accumulations, the Ukrainians could effectively spread disorganization among Russian and North Korean forces, to the point where Russian forces became unable to conduct proper combat operations.


10,632 posted on 01/14/2025 4:02:31 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10626 | View Replies]

To: PIF
If Trump gives Putin *anything* he wants - its a loss for the West

Donetsk, Kherson, Luhansk and Zaporizhzhia will remain liberated and Russian, Zelensky will be removed from power, the Nazification of Ukraine will be fully established and NATO for Ukraine will be a non-starter. Other than that, it's another Neocon win!

10,633 posted on 01/14/2025 4:08:03 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10616 | View Replies]

To: PIF
Trump can now safely call B-1s & B-52s to carpet bomb Russian positions.

Another fever dream? This nonsense sounds like a Speedy take.

10,634 posted on 01/14/2025 4:10:51 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10631 | View Replies]

To: blitz128

🍈 is continuing in his delusions of Russian grandeur. He must be shut in, due to the St Petersburg winter, with nothing else to do, poor sod.


10,635 posted on 01/14/2025 4:49:21 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10619 | View Replies]

To: PIF

Yes it is sad😎


10,636 posted on 01/14/2025 4:53:37 AM PST by blitz128
[ Post Reply | Private Reply | To 10635 | View Replies]

To: PIF

Buzz words like nazification actually make me chuckle. Look at behaviors and see which side behaves more like nazi germany and its leadership, and there is little difference between dear leader Putin and dear leader dolf.

But the 🍈 has all the buzz words down, almost like “he” is reading from a script 😎


10,637 posted on 01/14/2025 4:57:16 AM PST by blitz128
[ Post Reply | Private Reply | To 10635 | View Replies]

To: PIF

What is fascinating to me is the talk from the muskovites about how they can take the Baltics…. when they haven’t faced a strategic or even tactical Air Force.

One of the great stories from Syria is the stand by US forces against a “Russian” force. Credit to the soldiers on the ground, but the deciding factor was overwhelming air power. Something Russian has yet to face to any large measure.


10,638 posted on 01/14/2025 5:04:05 AM PST by blitz128
[ Post Reply | Private Reply | To 10631 | View Replies]

Like something out of a horror movie, a Ukrainian man makes a last-minute escape from conscription squads.

pic.twitter.com/7YBPR6kbbG— Creepy (@creepydotorg) January 14, 2025


10,639 posted on 01/14/2025 5:19:55 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10634 | View Replies]

Ireland - 13th January 2025

Ukrainian Welfare Tourists have taken a case against the Irish state for cutting disability and welfare payments 🇺🇦 💰

These Ukrainian grifters are a couple who arrived in Ireland in 2022. Have never paid a penny in taxes. Had everything paid for…

pic.twitter.com/W8hzAyrmTR— Paul (@PeterPaulGuy) January 14, 2025


10,640 posted on 01/14/2025 5:25:23 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10639 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 10,601-10,62010,621-10,64010,641-10,660 ... 20,261-20,262 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson