Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 0putinsfolly; 0putinswar; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynow; anydaynowputinwins; anydaynowrussiawins; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; jonputinbot; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 10,581-10,60010,601-10,62010,621-10,640 ... 22,121-22,122 next last

To: Travis McGee

I would rather the world end in nuclear war than yield to Little Pukin.

15 posted on 10/12/2022 4:02:03 AM PDT by SpeedyInTexas (RuZZia is the enemy of all mankind)

10,601 posted on 01/12/2025 9:58:35 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10401 | View Replies]


10,602 posted on 01/12/2025 10:09:18 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10601 | View Replies]

To: blitz128

🍈 has called in the big guns in his vain effort to kill the thread.


10,603 posted on 01/12/2025 10:35:20 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10595 | View Replies]

To: FtrPilot

Heading for Tartus, Syria Sparta https://www.vesselfinder.com/?imo=9268710
These are probably going there as well
Sparta II https://www.vesselfinder.com/?imo=9160994

General Skobelev https://www.vesselfinder.com/?imo=9503304

Sparta, Ivan Gren, and Aleksandr Otrakovskiy – remain anchored in an external roadstead near Tartus.Notably, the Otrakovskiy has reported leaks in its second& third fuel tanks.

Russian soldiers have been ordered to destroy all non-operational military vehicles awaiting evacuation in Tartus

https://bsky.app/profile/antongerashchenko.bsky.social/post/3lfk7kl2kms2q


10,604 posted on 01/12/2025 10:49:54 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10559 | View Replies]

To: PIF
Remember in grade school?

There was always one kid who, having nothing worthwhile to contribute to the gang, would try to make up for his lack of substance by being loud. The more he was ignored, the louder he got; the louder he got, the more he was ignored.

10,605 posted on 01/12/2025 11:11:53 AM PST by Mr. Lucky
[ Post Reply | Private Reply | To 10603 | View Replies]

To: Mr. Lucky

Remember in grade school?

Grade school? - at my age that’s so far back I cannot even remember where it was, let alone the other kids behavior.


10,606 posted on 01/12/2025 11:38:57 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10605 | View Replies]

To: PIF
“The Baltics should belong to Russia”, according to Russian MP and deputy head of the Defense Committee of the Duma, Aleksei Zhuravlev.

In particular, he claimed that Vilnius, the capital of Lithuania was rightfully Russian, as it was part of the Russian Empire. The deputy also noted that the Suwałki gap could be useful for Russia, as it would provide convenient supply routes to the Kaliningrad region. He urged the Lithuanian authorities to “hold their tongues,” adding that the Lithuanian army would not withstand a confrontation with Russia for even a single day.

These statements are no longer just coming from propagandists on television; they are being voiced by Russian officials. Russia has discarded its last inhibitions and no longer pretends to care about international law. Russia has become a country hated and feared by all its neighbors. It is unfamiliar with the language of culture and civilization. Its only method of communication is violence: threats, sabotage, bombings, and war. Russia's arguments are occupation and genocide.

https://x.com/Gerashchenko_en/status/1878382216046170429

10,607 posted on 01/12/2025 2:38:00 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10606 | View Replies]

To: AdmSmith

Big talk from the vassal state


10,608 posted on 01/12/2025 2:40:58 PM PST by blitz128
[ Post Reply | Private Reply | To 10607 | View Replies]

To: blitz128

It also proves that just because DJT is President and wants negotiations, the only successful negotiation for the Russians is be given everything they demand. Short of that, the war continues.


10,609 posted on 01/12/2025 3:14:45 PM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10608 | View Replies]

To: blitz128; AdmSmith; FtrPilot

My husband spent 3 years in Korea in the worst of it. He would not tell me how he got a 2 inch scar on his knee, when we were first married. He spoke some times about the 300,000 Chinese troops they had to face. My husband was 1/16th Cree Indian and from my mother’s Prussian ancestry I have some Asian in my heredity, so my older son has a dark and slightly swarthy look. When our son was a young teen my husband came home one day and was very upset (I think he had some friends recovering from their Vietnam experiences at that time), and started to cry “I killed somebody’s son.” He was deeply upset and I realized that scar on his knee was from hand to hand combat, and a lot of those Chinese soldiers were quite young. He was not dealing with infiltrators, but rather massive attacks of Chinese soldiers at least on this occasion. Of course he also fought North Koreans. He would sometimes talk about what great fighters the Turkish soldiers were who were taking part in this Police Action. So many people in pain, pain that will go on and on, for one man’s (and his “Brain’s”) dream of power and glory right now.


10,610 posted on 01/12/2025 9:55:06 PM PST by gleeaikin (in Question authority as you provide links )
[ Post Reply | Private Reply | To 10595 | View Replies]

To: gleeaikin

Thank you for sharing your story.


10,611 posted on 01/13/2025 12:50:41 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10610 | View Replies]

To: gleeaikin

Russian Offensive Campaign Assessment, January 12, 2025

The Ukrainian General staff reported on January 12 that Ukrainian forces conducted a high-precision airstrike on the command post of Russia’s 2nd Combined Arms Army [CAA] (Central Military District) in Novohrodivka, Donetsk Oblast.[1] The Ukrainian General Staff noted that the operation is part of a broader series of Ukrainian strikes targeting command posts of Russian forces operating in the Donetsk direction. The Ukrainian General Staff reported on January 8 and 10 that Ukrainian forces struck the command posts of the Russian 8th CAA (Southern Military District) in occupied Khartsyzk, Donetsk Oblast, and the 3rd Army Corps [AC] (Central Military District) in occupied Svitlodarsk, Donetsk Oblast, respectively.[2] Ukrainian strikes on tactical command posts and positions located near the frontline, such as the strike against Novohrodivka, are likely intended to disrupt Russian tactical activity and directly complicate Russian command and control (C2) on the battlefield. Ukrainian strikes against main command posts further in the Russian rear, such as the January 8 strike on the Russian 8th CAA post, are likely aimed at degrading broader Russian logistics and operational planning efforts, which could have impacts on Russia’s ability to conduct its military operations in western Donetsk Oblast. ISW has observed that the 2nd CAA is currently leading Russian operations south of Pokrovsk, that the 3rd AC is operating near Chasiv Yar, and that the 8th CAA is leading Russian efforts near Kurakhove.[3]

South Korea’s National Intelligence Service (NIS) confirmed that Ukrainian forces captured two North Korean soldiers during combat operations in Kursk Oblast on January 9.[4] The NIS told Agence-France-Presse (AFP) on January 12 that one of the captured North Korean soldiers initially believed that North Korean authorities had sent him to Russia for training but that he realized upon arrival that he would be engaged in combat - in line with recent statements from Ukraine’s Security Service (SBU) and Ukrainian President Volodymyr Zelensky.[5] One of the captured North Korean soldiers also stated that they suffered food and water shortages for several days before their capture and that North Korean forces have suffered significant losses.[6]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-january-12-2025


10,612 posted on 01/13/2025 1:06:49 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10590 | View Replies]


10,613 posted on 01/13/2025 1:09:02 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10527 | View Replies]

1,510 i.e. more than 1.04 Russians and Norks/min


10,614 posted on 01/13/2025 1:11:53 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10591 | View Replies]

To: PIF

It is possible that Putin is trying to use the “art of the deal”. Asking for more than he wants so when it appears that he accepts less he is actually getting what he wants or more. Problem for him is his people have been told he is going to get xy and z for their sacrifice and getting less than that will not play well. They have been repeatedly lied to about the situation on the front and general condition of military and economy, and if truth comes out he will not look good.
They war that began with his dreams of an expanded Russia with more power and prestige, has become a war to save himself.

Reminds me of another small man with a bad mustache.

When you play the “art of the deal” you have to have the cards in your hand to win. After almost 3 years he has played his cards, and his raises are all borrowed.


10,615 posted on 01/13/2025 3:20:13 AM PST by blitz128
[ Post Reply | Private Reply | To 10609 | View Replies]

To: blitz128

If Trump gives Putin *anything* he wants - its a loss for the West, as that would signal a weak West and an Trump would lose face and influence rapidly. Russia would immediately begin to rearm, until it was ready to attack the rest of Ukraine and the Baltics.

The only way peace can be obtained is a complete Russian withdrawal from all of Ukraine, including Crimea.

Short of that, China will see that the West is weak and can be negotiated with after an attack, getting most of, if not all, the goals of the invasion, and then attack Taiwan, aka Formosa.

Win-win for Putin and China.

Huge loss for Trump and his so-called art of the deal, signalling that he is now a full-fledged lame duck and a disaster for Europe and the West, a well as for allies like Japan & South Korea.


10,616 posted on 01/13/2025 4:40:59 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10615 | View Replies]

To: FtrPilot

For Speedy

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Russians Lose 50 Tanks & Armored Vehicles. Fields Filled With Russian Bodies ]

Today [ Jan 12, 8 pm ], the biggest news comes from the Kursk direction.

Here, Russian forces, after falling short of their operational goals, decided to go all-in in the most massive mechanized assault to secure a foothold in Malaya Loknya.

As the core of Ukrainian defenses held strong in the face of the Russian onslaught, Ukrainians are grinding down Russian offensive capabilities, pushing them ever closer to complete culmination.

The goal of the Russians was to once again try to approach Malaya Loknya by establishing a foothold in the settlement of Viktorovka. Since the previous Russian attempts at taking Malaya Loknya with frontal assaults failed, they adjusted their approach and tried to attack it from the south.

This way, they can cut off the Ukrainian forces in Malaya Loknya by establishing fire control over the main supply road, undermining the Ukrainian defensive operation. By establishing a presence in Viktorovka, the Russian forces would also be able to subsequently assault Malaya Loknya, since it is only administratively separate from Viktorovka, as both settlements are in an agglomeration.

To achieve this, the Russians launched a series of 6 massive combined assault waves, with the total of 50 vehicles and hundreds of soldiers engaged, launching wave after wave, until they accumulated enough soldiers in Viktorovka from the survivors of the attacks.

The main advantage of the Russian forces in this area was the road and frozen ground in the fields, which allowed Russians to maneuver more rapidly, decreasing the time Ukrainians had to respond to the Russian attacks. The significant number of armored vehicles also gave Russians a distinct advantage in firepower, allowing the Russian stormtroopers to overwhelm Ukrainian defenses.

However, if we look at the topographic map, we can see that the main Ukrainian positions in Malaya Loknya are located at a higher elevation, which allows them to observe and detect Russian movements along the road.

This means that the Ukrainian forces in Malaya Loknya can enforce fire control over the Russian mechanized units, using anti-tank missiles and FPV drones to target Russian vehicles. Simultaneously, the Ukrainians placed land mines across the road to Viktorovka, which could disable the lead vehicle, and halt the entire armored column with it.

Combat footage from the area reveals the demise of the Russian mechanized assault units sent to Viktorovka. The lead vehicle of each column was effectively disabled by land mines or FPV drones, which stopped each vehicle behind it.

Scared of becoming sitting ducks for Ukrainian artillery, the Russian soldiers immediately dismounted from their BMPs, once they stopped driving and attempted to take cover in nearby trenches and dugouts. This effectively isolated the Russian soldiers, as they became pinned down by Ukrainian small arms fire from the settlements, making them easy targets for Ukrainian drone operators dropping grenades directly from above.

However, due to the massive scale of these attacks, Russians have been able to advance and clear out the grey zone within the villages of Leonidovo and the eastern part of Novoivanovka.

However, it is important to note that the newly captured Russian ground mainly consists of just fields, with the only controlling factor being Novoivanovka and Leonidovo. Additionally, Ukrainians only maintained a limited presence here due to the settlements already being reduced to ruins in previous assaults.

Most importantly, these gains did not come without a cost, as Russians lost nearly a full mechanized company in one day, without achieving their goal of taking Vikorovka, and only taking swaths of fields. Recently released footage shows Russian soldiers filming as they move along their newly captured terrain, revealing a large number of dead Russian soldiers along the road and in the field, already slowly becoming buried in the snow.

Overall, the Russians launched a poorly organized attack along a narrow area of a road, bunching up their armored formations and turning them into sitting ducks, once the lead vehicles were disabled, allowing Ukrainians to inflict massive casualties, despite the lost terrain.

While the Russians have made significant gains in the western part of the salient, Ukrainians have ground down the Russian and North Korean combat capabilities over several weeks, while Russians are only now getting closer to the core of the Ukrainian salient, where Ukrainian logistics are stronger, and defenses more robust.


10,617 posted on 01/13/2025 4:42:07 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10597 | View Replies]

To: AdmSmith

OT
Starship Flight 7 launch delayed until the 15th

There are several dates possible as long as the weather remains bad. Heavy overcast now.


10,618 posted on 01/13/2025 6:31:29 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10614 | View Replies]

To: PIF

Agreed I don’t see Trump giving in to putin, but I also don’t see Putin’s giving in willingly, frankly his power and his life is at stake. Wouldn’t be the first time a Russian leaders rule has ended badly for them


10,619 posted on 01/13/2025 6:41:52 AM PST by blitz128
[ Post Reply | Private Reply | To 10616 | View Replies]

To: blitz128; PIF; FtrPilot; gleeaikin
19DEC2024 The head of the FSB military counterintelligence department, Nikolai Yuryev, has retired of his own accord, sources told RBC.

The decree on the general's dismissal was signed on Monday, December 16, one of RBC’s sources said. According to him, Yuryev retired of his own free will. The RBC source also said that the decision to resign was made this summer. Apart from Yuryev, no one else is leaving the department, all the deputies are staying, he noted. “While the position of head is vacant, the name of the candidate is not being announced,” the source said. He added that one of Yuryev’s deputies will temporarily act as head of counterintelligence.

RBC sent a request to the Public Relations Center of the Russian FSB.

“The main tasks of the military counterintelligence department of the FSB of Russia and security agencies in the troops are to suppress the aspirations of foreign intelligence agencies to the Armed Forces of the Russian Federation, obtain intelligence information about security threats, suppress terrorist and sabotage activities directed against the troops, as well as ensure the protection of information constituting a state secret, the fight against organized crime, corruption, illegal arms and drug trafficking in the troops,” Yuryev said in a 2018 interview with TASS .

He also noted that the main task of the military counterintelligence task force in Syria is to ensure the security of the Russian Aerospace Forces base, and the information obtained by the task force is used by the command when making decisions on conducting special and military operations.

https://www.rbc.ru/politics/19/12/2024/67644b419a79476e290ae320

12JAN2025
Кремлевская табакерка
Former head of FSB counterintelligence Nikolai Yuryev has been detained

Sources in the FSB told us that last week the former head of the FSB military counterintelligence department, Colonel General Nikolai Yuryev, was detained. Let us recall that he resigned from his post in December last year after the murder of Lieutenant General Igor Kirillov (chief of the Radiation, Chemical and Biological Defense Troops) in Moscow.

We will clarify what exactly Yuryev is accused of and who gave the order to detain him. It is curious that Yuryev officially retired of his own free will. He knows a lot. In December, sources said that he was allowed to retire in exchange for silence . And this despite the fact that the president called Kirillov’s murder “a grave blunder.”

There is no information yet on where Nikolai Yuryev is now.

https://t.me/kremlin_secrets/5162

10,620 posted on 01/13/2025 8:29:12 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10619 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 10,581-10,60010,601-10,62010,621-10,640 ... 22,121-22,122 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson