Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 10,421-10,44010,441-10,46010,461-10,480 ... 18,701-18,718 next last
To: dennisw

The Yamal area (the Peninsula, surrounding waters and a bit to the South) produces (produced) more than 70% of Russia’s natural gas.

It has harsh Arctic conditions. “Yamal” literally translates as the end of the land. Nothing else but some reindeer herders.

There is vast, undeveloped and uninhabited wasteland between those gas deposits and China.


10,441 posted on 01/07/2025 9:25:12 AM PST by BeauBo
[ Post Reply | Private Reply | To 10434 | View Replies]

To: BeauBo

Wonder if they get WWPD bracelets as well

Perhaps my favorite were “priests “ blessing statues of stalin

WWPD


10,442 posted on 01/07/2025 9:30:47 AM PST by blitz128
[ Post Reply | Private Reply | To 10439 | View Replies]

To: blitz128; FtrPilot

“Figured that (intercepting drones and missiles) is what they (Ukrainian F-16s) would be doing, rather than complex multiship operations”

You and FtrPilot both called it.

Looking ahead to 2025, as the numbers of Ukrainian airframes increases, as well as the numbers and skill levels of pilots, perhaps we will see other types of missions increase.

Indications are that Russia will continue, or even significantly increase, their high volume of drone attacks. Drones and meat waves seem to be the main things that they are able to pull off, and a lot of investment has been made into drone manufacturing, and missile/drone procurement from Iran and North Korea.


10,443 posted on 01/07/2025 9:37:57 AM PST by BeauBo
[ Post Reply | Private Reply | To 10437 | View Replies]


10,444 posted on 01/07/2025 9:46:15 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10312 | View Replies]

1,970 i.e. more than 1.36 Russians and Norks/min. and more than 800,000 !


10,445 posted on 01/07/2025 9:49:32 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10357 | View Replies]

JUST IN: 🇺🇸🇷🇺 President Trump says he understands why Russia doesn't want Ukraine to join NATO and blames Joe Biden for the war in Ukraine.

"Russia for many years said you could never have NATO involved with Ukraine. That's been like written in stone. And Biden said no, they… pic.twitter.com/T0RQhlB6mR— BRICS News (@BRICSinfo) January 7, 2025


10,446 posted on 01/07/2025 10:19:05 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10445 | View Replies]

Ukrainians how is the Kursk OFFENSIVE going?

— Anna (@provemewrong411) January 7, 2025


10,447 posted on 01/07/2025 10:48:46 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10446 | View Replies]

To: JonPreston
Make this stop

Ukrainian forces have been pushed out of Makhnovka south of Sudzha, Kursk. pic.twitter.com/8VLWYoaPeP— KalibratedMaps (@Kalibrated_Maps) January 7, 2025


10,448 posted on 01/07/2025 10:49:59 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10401 | View Replies]

Well, this was unexpected… The Russians are taking lots of prisoners in the Kursk region. Apparently, Ukrainians now go there to surrender en masse.
pic.twitter.com/hvBHyWeUIY— Gabe (@GabeZZOZZ) January 7, 2025


10,449 posted on 01/07/2025 10:50:48 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10401 | View Replies]

To: BeauBo; blitz128; FtrPilot; PIF

10,450 posted on 01/07/2025 10:52:39 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10443 | View Replies]

To: JonPreston

‼️🇷🇺🇺🇦🪖SHOCKING: Retreating #Ukrainian invaders in Kursk caught by a #Russian surveillance drone throwing their own wounded men out of trucks in panic!

‼️The Western media will never show you this! pic.twitter.com/bvsHKs5fko— Maimunka News (@MaimunkaNews) January 7, 2025


10,451 posted on 01/07/2025 10:53:19 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10401 | View Replies]

To: JonPreston

Massive losses of Ukrainian forces, who launched another suicide offensive on Bolshoe Soldatskoe in the Kursk region for Zelensky and NATO

"The last couple of days will be remembered by the Ukrainians for a long time! But not all of them," writes Russian General Apti Alaudinov. pic.twitter.com/aOfFYqMa4o— Chay Bowes (@BowesChay) January 7, 2025


10,452 posted on 01/07/2025 10:54:45 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10451 | View Replies]

Donald Trump announces he intends to change the name of Gulf of Mexico to Gulf of America. pic.twitter.com/Oe2lTjd5RG— Pop Base (@PopBase) January 7, 2025


10,453 posted on 01/07/2025 10:56:13 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10452 | View Replies]

To: blitz128
______I did maintenance on Kc-135s for almost 40 years they me be “ancient” in terms of manufacture date, but when it comes to modernization , avionics, engines, brakes…. They are pretty modern and reliable unlike its “replacement “_____

This is serious work. Good to hear they are still reliable.Tankers are a necessity. The US has used them recently when Iran set a missile barrage to Israel.

Israeli tankers are 707s that they converted. These were used when Israel unleashed on Iran 6 weeks ago.

10,454 posted on 01/07/2025 10:59:20 AM PST by dennisw
[ Post Reply | Private Reply | To 10436 | View Replies]

To: JonPreston

“how is the Kursk OFFENSIVE going?”

Another 1,970 Russian casualties yesterday.

How tall of a pile of bodies is that, for Putin’s unholy altar?

More than an Olympic-sized swimming pool’s worth of Russian blood, every year, to satisfy Putin’s insatiable lust for conquest and theft.

What will it take for Russians to make a stand against such an evil bloodthirsty killer, who is so totally given over to evil, that he openly names his weapons of mass destruction after his true Lord and Master, Satan (Sarmat, in Russian)?


10,455 posted on 01/07/2025 11:21:37 AM PST by BeauBo
[ Post Reply | Private Reply | To 10447 | View Replies]

To: BeauBo

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Deep Penetration: Kursk Frontline Collapses!! ]

Today [ Jan 07, 8 pm ], there are a lot of important updates from the Kursk direction.

Here, the Ukrainian forces have launched a surprise counteroffensive in the Kursk direction, aiming to exploit gaps in the overstretched Russian and North Korean defenses.

With superior forces and tactical terrain advantages on their side, the Ukrainians have launched a new offensive toward key positions that could redefine control in the region.

The goal of the Ukrainian offensive in the area is to reach Bolshoe Soldatskoye and diminish the Russian tactical gains achieved during the last 3 waves of their counteroffensives. Such a move could effectively collapse the Russian lines and force them to a defensive posture, completely throwing off the Russian plans for pushing Ukrainians out of Kursk.

By widening their bridgehead, the Ukrainians can cancel out all Russian counteroffensive efforts and effectively retake the initiative for the 1st time since August. During the previous Russian counteroffensive efforts from September until now, the Russian and North Korean forces in Kursk sustained losses so heavy that they could no longer launch attacks toward the Ukrainian positions, indicated by the recent Russian redeployment of additional forces from their offensives in Eastern Ukraine to Kursk.

Furthermore, the largest concentration of Russian and North Korean forces was in the western part of the salient, around Novoivanovka. This situation exposed gaps in the Russian and North Korean lines, which created an opportunity for a Ukrainian counterattack to disrupt their combined efforts.

By launching a rapid counterattack now, the Ukrainian forces could effectively take advantage of gaps in Russian lines, before the Russian reinforcements could arrive and take up positions. Ukrainians understood that the lower frontline activity northeast of Sudzha meant that the Russian garrison here was likely stretched thin, leading to the settlement of Berdin being the weakest link in the Russian line, and the focus point for the Ukrainian spearhead.

The main tactical advantage of the Ukrainians is the element of surprise, combined with numerical superiority in this section of the front.

As Ukrainians maintained an extremely favorable casualty ratio to the past Russian and North Korean human wave offensives, Ukrainian forces had room to prepare several battalions of their reserve units to exploit this gap for a breakthrough. The Ukrainian attack was also made possible by the proximity of their units to Sudzha, their main supply hub, which significantly increased the strength of their nearby logistics and accelerated their offensive.

If we look at the topographic map, we can also see that all villages near the main highway are in the lowlands, while the highway is at a higher elevation. This means that there are no kill zones for Russians to easily eliminate the Ukrainian assault, as Russians have to fire up at the convoy, while Ukrainians can rain down fire on them as they drive past.

On top of that, Ukrainians deployed powerful electronic warfare systems in the area to prevent any Russian drones from reaching the column.

However, Russians had preemptively mined the highway to prevent such an exact Ukrainian surprise assault. Unfortunately for Russians, the ground had frozen and hardened from freezing December temperatures, combined with there being little combat here to unearth the frozen ground.

Recently released footage shows that this allowed Ukrainians to move across the fields along the highway, circumventing the Russian mines, as mine-clearing vehicles led the convoy just in case.

Additional footage shows the Ukrainian convoy firing on Russian positions as they drove past, eliminating the threat of coming under a Russian crossfire. Lastly, footage from Russian drone operators shows them attempting to strike the Ukrainian convoy, but the connection immediately being disrupted by Ukrainian electronic warfare.

Overall, Russians had completely exhausted their offensive capabilities in Kursk, exposing vulnerable weak points in their defenses, which Ukrainians masterfully exploited. As a result of the Ukrainian surprise assault and tactical superiority, preliminary information indicates that Ukrainians have overwhelmed the Russian skeleton force guarding Berdin, and have taken full control of the settlement and the surrounding area.

If Ukrainians can successfully consolidate their control here, they will create a strong launching pad for a follow-up attack toward Bolshoe Soldatskoye, the key Russian deployment point and logistics hub for all Russian operations east of Sudzha.


10,456 posted on 01/07/2025 11:23:20 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10443 | View Replies]

To: PIF
Putin Death Watch


10,457 posted on 01/07/2025 11:45:40 AM PST by BeauBo
[ Post Reply | Private Reply | To 10456 | View Replies]

To: dennisw

The KC-135s are also modified Boeing 7O7s actually built on the original smaller airframe before Boeing enlarged the 707 production line.

The reality is besides major structural parts there is little on the 135 that have not been changed and upgraded.

I have been to depot maintenance where the planes are literally stripped of their aluminum skins and reskinned.

The Boeing of old should be proud of the KC-135s and B-52s still flying.

Remarkable


10,458 posted on 01/07/2025 11:57:21 AM PST by blitz128
[ Post Reply | Private Reply | To 10454 | View Replies]

To: BeauBo

I am curious to know the state of the Russian air fleet. Would imagine maintenance is not great, who knows about spare parts. We often had to cannabalise parts off broke planes to keep others flying even with a decent supply chain.

Total numbers don’t tell the whole story


10,459 posted on 01/07/2025 12:01:12 PM PST by blitz128
[ Post Reply | Private Reply | To 10443 | View Replies]

To: BeauBo

🍈 is spewing out posts like Putin’s meat waves of men,‘surely even more will win the day😎


10,460 posted on 01/07/2025 12:06:03 PM PST by blitz128
[ Post Reply | Private Reply | To 10457 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 10,421-10,44010,441-10,46010,461-10,480 ... 18,701-18,718 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson