Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 0putinsfolly; 0putinswar; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynow; anydaynowputinwins; anydaynowrussiawins; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; jonputinbot; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 10,201-10,22010,221-10,24010,241-10,260 ... 22,161-22,164 next last

Moscow Drunk Bolsheviks celebrate New Year

https://x.com/BeRuzzia/status/1874470625357742341
16 sec video


10,221 posted on 01/02/2025 2:51:30 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10220 | View Replies]

To: BeauBo

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Grenade Launchers From All Sides Obliterate North Koereans ]

Today [ Jan 01, 8 pm ], there are a lot of interesting updates from the Kursk direction

Here, North Korean forces attempted a risky advance through a narrow forest corridor, hoping to outmaneuver Ukrainian defenses and launch an assault on Kruglenke. Instead, they found themselves trapped in a deadly funnel, as Ukrainian fighters unleashed automatic grenade launchers and drone strikes, annihilating the tightly packed assault force before they could even reach their objective.

Despite a lack of tactical gains, North Korean forces persist with their attacks in the direction of Kruglenke, hoping to gain at least some small foothold, because all assaults in other parts of the northern Kursk salient failed disastrously. Kruglenke remains the only remaining vector of attack where the North Koreans must advance to prevent the counteroffensive effort from being total failure.

North Korean commanders recognized that the lack of effective cover, left their soldiers highly vulnerable to Ukrainian reconnaissance and precision fire. This necessitated establishing a foothold in Kruglenkoe, as the village offered approximately 50 houses with basements that could provide significantly better concealment from Ukrainian shelling and drone strikes.

To achieve this, the North Koreans started amassing their forces in the forest north of Kruglenke, and despite suffering heavy losses in an attempt to cross the fields [ about 4 km from the Front ], as described in the previous report, some survivors managed to reinforce the positions after many waves of attacks.

From there, they plan to advance southward, using the cover of two narrower forests closer to the village. By positioning their troops at the southernmost edge of the forest, they would reduce the distance to Kruglenke to just 200 meters, enabling a rapid assault on the village.

From the large forest, the path narrows as it stretches through southern forests, connecting to their primary positions in the north. This 4km long, 100-meter-wide corridor takes the North Koreans at least an hour to traverse on foot. Predictable and previously targeted by Ukrainian forces, this path slows the large assault group, giving the Ukrainians ample time to detect their movements.

As the forest becomes narrower, the assault group is forced into tight formations, making them an ideal target. With insufficient training and little awareness of advanced drone reconnaissance, the North Koreans continue down this path and regroup at the forest’s southern edge, before launching their assault across the open fields toward Kruglenke.

With minimal cover in the narrow forests, North Korean soldiers were highly exposed to concentrated fire, unable to maneuver effectively or establish proper firing positions.

Ukrainian fighters in Kruglenke capitalized on this vulnerability by employing British-supplied Mark 17 automatic grenade launchers, delivering precise and devastating fire on North Korean positions across the fields. The combination of a high rate of fire and high-explosive rounds caused severe casualties among the densely packed troops in the confined forest.

Compounding their plight, Ukrainians deployed hexacopters equipped with multiple thermobaric grenades. These drones, capable of carrying more munitions than standard models, relentlessly bombarded the North Koreans, eliminating dozens of soldiers in a single sortie.

The result of the Ukrainian campaign of precision strikes was disastrous for the North Koreans, as only a handful of them survived, with all survivors being left wounded, among dozens of other fighters that were killed. The wounded survivors eventually were limping back to the rear positions, surrounded by the corpses of their fallen comrades.

Overall, the North Koreans launched a brutal attack through the narrow space of the forests, where they had to bunch up their stormtroopers, which allowed the Ukrainians to easily target them with concentrated drone strikes and automatic grenade launcher fire.

Ukrainian fighters in the area report that precision bombing of North Korean soldiers is simpler and less challenging than even targets during their training.

Artillerymen and drone operators know exactly which part of the forests they should strike to maximize North Korean losses, and undermine their offensive completely.


10,222 posted on 01/02/2025 4:39:45 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10213 | View Replies]

To: PIF

Ukrainian fighters in the area report that precision bombing of North Korean soldiers is simpler and less challenging than even targets during their training. 🤣🤣🤣🤣🤣🤣


10,223 posted on 01/02/2025 4:40:32 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10222 | View Replies]

To: BeauBo; JonPreston

lolsszzz and like! A suitable rejoinder to DimBulb pirate Jon Preston


10,224 posted on 01/02/2025 5:29:02 AM PST by dennisw
[ Post Reply | Private Reply | To 10181 | View Replies]

To: JonPreston

Speedy Gonzales had moved on to greener pastures. With pirate-Klown Jon Preston partly to blame


10,225 posted on 01/02/2025 5:31:37 AM PST by dennisw
[ Post Reply | Private Reply | To 10200 | View Replies]

To: PIF

Good report. You singed up for Telegram? I might do it with a virtual phone number... If I can do this. I don’t like giving apps my phone number.


10,226 posted on 01/02/2025 5:34:32 AM PST by dennisw
[ Post Reply | Private Reply | To 10222 | View Replies]

To: dennisw
Excuse me Denny Dimwit, the posters on this now Abandoned Ukraine War Porn Thread have been instructed not to speak to me directly. Please refer to me indirectly, if at all


10,227 posted on 01/02/2025 5:37:17 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10224 | View Replies]

To: dennisw
Jon Preston partly to blame

100%

His mangy, war-loving scalp is on my wall

10,228 posted on 01/02/2025 5:39:13 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10225 | View Replies]

To: dennisw

You singed up for Telegram?

No. I tried, but it requires you to use your phone which I did not like.


10,229 posted on 01/02/2025 6:32:06 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10226 | View Replies]

To: JonPreston
Nice self-portrait JonBoy!

10,230 posted on 01/02/2025 6:37:43 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10227 | View Replies]

To: PIF

That’s Denny Dimwit. Use your Google Machine and whatever is left of your sense of humor.


10,231 posted on 01/02/2025 7:03:59 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10230 | View Replies]

To: PIF
Russia has definitely reached the stage of a coup

The scenario of the collapse of power will change, but not the collapse itself. Russia has now definitely reached the plot that occurred in February 1917 - a coup by the hands of the nobility itself.

The resource field is shrinking, so the ruling elite generates internal contradictions, which sooner or later will be realized in civil strife. In this sense, the regime is now forced to conduct anti-crisis management simply because it is no longer able to manage the processes occurring in the ruling stratum in any other way than through mobilization. Therefore, it needs permanent crises as sources of such management. But these crises in turn generate new contradictions in the ruling environment and exacerbate the existing ones. The more the spring is compressed, the stronger its desire to unclench.

The plot of the new February in Russia may have two scenarios. The banal one: through a top-level coup or a transition to a civil conflict, the organizing parties of which will be different ruling groups. Or perhaps a combination of these scenarios in different variations.

This, of course, will not be the classic medieval feudal fragmentation, a kind of “Game of Thrones”, but the general picture is somewhere close to it. It is worth clarifying that in such a plot no “people's leaders” will emerge - they simply will not have time to create their own independent organizational structures. Any “people's leader” can exist in such a situation only as a proxy - either for an external player or for an internal one, and the latter is more doubtful. A very suitable illustration is the “people's leader” of the victorious Syrian revolution, Sharaa, aka Julani.

https://charter97.org/ru/news/2024/12/29/624338/

10,232 posted on 01/02/2025 7:11:24 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10230 | View Replies]

Ending War in Ukraine May Generate ‘Almost as Big a Crisis for the Kremlin as Its Beginning,’ Pertsev Says

Dec. 27 – For three reasons, the end of the war in Ukraine could quickly become “almost as big a crisis for the Kremlin” as the beginning of that conflict, Andrey Pertsev says. Russian elites will want the Kremlin to resume its role as regulator and the Russian people will want to know what to expect next, but Vladimir Putin won't be able to provide either.
The past year, the Riddle Russia commentator says, major conflicts have arisen among elite groups in Moscow, with one of the most powerful, that of Sergey Shoygu being destroyed, and gunfire being heard in the streets of the Russian capital for the first time since the 1990s ( https://ridl.io/ru/god-bolshogo-razloma/ ). This has occurred, Pertsev argues, because “Putin's age and passion for war have effectively removed him from arbitration” of disputes among the clans,” the dwindling resources in the country mean that the struggle for control of what's left has intensified, and Putin's reluctance to change people around him means that those who seek change there must attack.

The situation has deteriorated to the point, he continues, that one is forced to conclude that “Russia's elites are entering the new year in a state of all-our war [and] the struggle among clans and groups is becoming part of the power vertical's pre-programmed software,” the norm rather than the exception. That change in the elites took place even as a more fundamental change took place in Putin himself: He has become the opposite of what he sought to present himself as being up until now. “Instead of a macho man, arbiter and guarantor, he showed himself to be a verbose, talkative pensioner” who simply could not keep a secret or avoid appointing relatives. According to Pertsev, “this combination of personal qualities will be Putin's main problem in the year ahead. His age has been one of the main grievances Russians have against him to judge from the polls, and there are more and more details about him that throw that into high ,.

Related to both of these and making the entire situation less stable is the fact that the Kremlin “has yet to give Russians some clear and comprehensive reason for the launch of the war and the reasons for its continuation.” Putin and his team talk about these things in words without any clear meaning. “As a result,” Pertsev says, “society isn't fully involved with the war; and those who volunteer to fight at the front are doing so for the hefty paychecks they have been promised” rather than out of any specific loyalty to Putin and his regime. Ending the war won't end this problem. Indeed, the commentator suggests, it could bring everything to a head. That may be yet another major reason why Putin shows so little sign of really seeking an end to the conflict.

https://windowoneurasia2.blogspot.com/2024/12/ending-war-in-ukraine-may-generate.html

10,233 posted on 01/02/2025 7:21:47 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10232 | View Replies]

LINK

Ukrainian soldiers trained by French army go AWOL before shot fired

Joe Barnes

The Telegraph

About 1,700 soldiers from a Ukrainian unit equipped by the West and trained in France went AWOL before a shot was even fired.

At least 50 members of the new 155th mechanised brigade, one of the few to operate the Leopard 2 battle tank, disappeared while elements of the unit were being drilled in France.

The mass exodus came before the brigade was deployed to Pokrovsk, the key logistics hub anchoring Ukraine’s defence against Russian advances in the eastern Donetsk region.

Entering the battle in recent days, it suffered heavy losses, reportedly including some of its tanks and armoured vehicles.

It prompted the Ukrainian State Bureau of Investigations to investigate the seemingly shambolic formation of the 155th.

The brigade, also known as Anne of Kyiv, was meant to have more than 5,800 troops and be equipped with some of the best equipment, including Leopard tanks and French Caesar 155mm howitzers.

Volodymyr Zelensky, Ukraine’s president, and Emmanuel Macron, his French counterpart, announced the $900 billion (£747 billion) project to much fanfare at an event to commemorate the 80th anniversary of the D-Day landing in June last year.

10,234 posted on 01/02/2025 7:29:34 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10231 | View Replies]

To: AdmSmith

Putin Death watch begins.


10,235 posted on 01/02/2025 7:54:07 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10233 | View Replies]

To: JonPreston
LINK

Numerous Russian military convoys heading north from occupied Crimea

"KAMAZ trucks with cargo, fuel trucks, radar stations, 152mm D-20 howitzers and other equipment" are reportedly being moved toward the cities of Krasnoperekopsk and Armyansk on the Crimean isthmus, and then on to the occupied part of Kherson Oblast.


10,236 posted on 01/02/2025 7:55:45 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10234 | View Replies]

To: PIF

Apparent anti-Trump cybertruck bomber was a Special Forces operative who wore ‘Slava Ukraini’ shirt

pic.twitter.com/53MD83aAs6— Jack Poso 🇺🇸 (@JackPosobiec) January 2, 2025


10,237 posted on 01/02/2025 7:59:35 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10235 | View Replies]

To: AdmSmith; PIF; FtrPilot; blitz128; BeauBo

I decided to read the complete LINK listed above the comment that follows your comment #10,233, as the information written there was concerning.

It appears there was a difference of opinion among some of the Ukraine military leaders. Some were concerned that it was not sensible to organize completely new military units for special training outside Ukraine. Those with this view felt it was better to use these volunteers to reinforce existing groups in need of replacements. A number of troops originally considered missing/AWOL, are now considered returned, and all have been assigned to existing units and the program ended.

Other problems that surfaced included the fact that very few of the volunteers had had a year of military experience, 2 months was often all they had. When training was complete and these independent groups were fielded for combat they were NOT equipped with Ukraine’s best weapon, THE DRONE. Thus certain large pieces of important new military equipment they had been trained to use were lost as these new units were improperly supplied for defense. I presume important lessons have been learned which are unlikely to be repeated given Ukrainian capacity to learn from experience.

I wonder if this was a case like the one last summer which had bad combat results. Ukraine had been advised to fight a certain way by NATO folks, and it had not worked well. It may have been a bad idea to put Ukranian men who had been living in wartime Ukraine out in the more attractive, war free places where they were trained. In fact some may have volunteered for that very reason.


10,238 posted on 01/02/2025 8:12:04 AM PST by gleeaikin (in Question authority as you provide links )
[ Post Reply | Private Reply | To 10233 | View Replies]

To: dennisw

Holy smokes. The Cybertruck bomber was apparently setting up recently retired Special Forces guys with contracts to go to Ukraine. pic.twitter.com/D9MeDSR1Uk— johnny maga (@_johnnymaga) January 2, 2025


10,239 posted on 01/02/2025 8:27:28 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10225 | View Replies]

From the Cybertruck Bomber


10,240 posted on 01/02/2025 8:29:44 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10239 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 10,201-10,22010,221-10,24010,241-10,260 ... 22,161-22,164 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson