Free Republic
Browse · Search
Smoky Backroom
Topics · Post Article

Skip to comments.

Advertisement Giant bacteria FIVE THOUSAND times bigger than normal are discovered in a Caribbean mangrove swamp – and they are even visible to the naked eye
daily mail ^

Posted on 06/23/2022 3:24:01 PM PDT by algore

click here to read article


Navigation: use the links below to view more comments.
first previous 1-2021-4041-49 last
To: moovova

Nice. Surly there are many coronavirus shirts too.


41 posted on 06/24/2022 1:31:43 PM PDT by Veto! (FJBsucksrocks)
[ Post Reply | Private Reply | To 39 | View Replies]

To: moovova

And just like that::

https://www.zazzle.com/fauci_bioweapon_survivor_long_sleeve_t_shirt-235420460527595100


42 posted on 06/24/2022 2:16:25 PM PDT by Veto! (FJBsucksrocks)
[ Post Reply | Private Reply | To 39 | View Replies]

To: Veto!

That’s good!


43 posted on 06/24/2022 3:10:06 PM PDT by moovova
[ Post Reply | Private Reply | To 42 | View Replies]

https://freerepublic.com/focus/chat/4073844/posts

https://www.britannica.com/place/Soufriere-volcano-Guadeloupe


44 posted on 06/25/2022 8:18:32 PM PDT by SunkenCiv (Imagine an imaginary menagerie manager imagining managing an imaginary menagerie.)
[ Post Reply | Private Reply | View Replies]

To: algore; StayAt HomeMother; Ernest_at_the_Beach; 1ofmanyfree; 21twelve; 24Karet; 2ndDivisionVet; ...
Thanks algore.

45 posted on 06/26/2022 5:22:54 AM PDT by SunkenCiv (Imagine an imaginary menagerie manager imagining managing an imaginary menagerie.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: algore

Everything is bigger

Thiomargarita magnifica
Its threadlike single cell is visible to the naked eye, growing up to 2 centimeters—as long as a peanut—and 5000 times bigger than many other microbes. What’s more, this giant has a huge genome that’s not free floating inside the cell as in other bacteria, but is instead encased in a membrane, an innovation characteristic of much more complex cells, like those in the human body.

The largest T. magnifica cell Volland found was 2 centimeters tall, but Carvalho thinks that if not trampled, eaten, blown by wind, or washed away by a wave, they could grow even bigger.

The DNA-filled sac, also squished along the inner edge of this bacterium, proved extraordinary as well. When researchers at the Department of Energy Joint Genome Institute sequenced the DNA inside, they found the genome was huge, with 11 million bases harboring some 11,000 clearly distinguishable genes. Typically, bacterial genomes average about 4 million bases and about 3900 genes.

By labeling the DNA with fluorescent tags, Volland determined the bacterium’s genome was so big because there are more than 500,000 copies of the same stretches of DNA.

https://www.science.org/content/article/largest-bacterium-ever-discovered-has-unexpectedly-complex-cells

smallest bacteria
perhaps Nanoarchaeum equitans
Its cells are only 400 nm in diameter, 580,070 base pairs.

https://en.wikipedia.org/wiki/Nanoarchaeum_equitans

largest virus

Pandoravirus salinus
500nm wide and 1000nm long

Linear, dsDNA genome of about 2,473k base pairs
https://viralzone.expasy.org/4238

smallest virus
Perhaps this: Porcine circovirus (PCV) are the smallest viruses replicating autonomously in eukaryotic cells,
The DNA sequence for Porcine circovirus type 2 strain MLP-22 is 1726 base pairs long


46 posted on 06/27/2022 5:42:46 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: algore; SunkenCiv

47 posted on 06/27/2022 7:42:54 AM PDT by Red Badger (Homeless veterans camp in the streets while illegal aliens are put up in hotels.....................)
[ Post Reply | Private Reply | To 1 | View Replies]

To: algore

When viruses come out of the closet.

Wonder what month will be Virus Pride Month?


48 posted on 06/27/2022 7:45:47 AM PDT by N. Theknow (Kennedys-Can't drive, can't ski, can't fly, can't skipper a boat-But they know what's best for you.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Red Badger

Definitely need the largest size.


49 posted on 06/27/2022 9:28:58 AM PDT by SunkenCiv (Imagine an imaginary menagerie manager imagining managing an imaginary menagerie.)
[ Post Reply | Private Reply | To 47 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041-49 last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Smoky Backroom
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson