Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

New York Post Hacked; Anti-WikiLeaks Editorial Redirected to Dummy Site
Saturday, August 14, 2010 | Kristinn

Posted on 08/14/2010 6:53:18 AM PDT by kristinn

click here to read article


Navigation: use the links below to view more comments.
first previous 1-2021-4041-49 next last
To: wiggen; SunkenCiv

How come there are no leaks about Russia, Putin, Chavez, Cuba, Iran etc?


21 posted on 08/14/2010 7:39:43 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 14 | View Replies]

To: kristinn

From the picture, he looks like he’s related to Soros.

Frankly, I don’t expect any action out of our government on this. He’s on the same side as our president, and that is not the side of America.


22 posted on 08/14/2010 7:48:22 AM PDT by meyer (Our own government has become our enemy,...)
[ Post Reply | Private Reply | To 1 | View Replies]

To: kristinn

One word

MOSSAD


23 posted on 08/14/2010 7:49:30 AM PDT by Roccus (......and then there were none.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: All
The website Newsabi.com, which also posted the New York Post "WikiKills" editorial, has been hacked and redirected.
24 posted on 08/14/2010 7:59:09 AM PDT by kristinn (Since Jul 31, 1998)
[ Post Reply | Private Reply | To 1 | View Replies]

To: kristinn

The dude that leaks this stuff is no better than the enemy we are fighting in the war on terror. He is the quintessential enemy withing, along with his willing accomplices on the left.


25 posted on 08/14/2010 8:09:33 AM PDT by b4its2late (Ignorance allows liberalism to prosper.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: kristinn

There was a time not long ago when this kind of activity and the persons perpetrating it would have been terminated with extreme prejudice.


26 posted on 08/14/2010 8:12:54 AM PDT by P-Marlowe (LPFOKETT GAHCOEEP-w/o*)
[ Post Reply | Private Reply | To 1 | View Replies]

To: library user

“The guy behind these leaks should be carbombed.”

Nah. The appropriate punishment would be for some smart hacker to break into his web site and plant his name among the leaked names of informants in various after action reports.


27 posted on 08/14/2010 8:17:25 AM PDT by Brilliant
[ Post Reply | Private Reply | To 2 | View Replies]

To: library user

This guy is only making the public aware of what is out there.

The Chinese and other world enemies have these kind of hacking skills galore. Nothing much is safe anymore.


28 posted on 08/14/2010 8:19:13 AM PDT by George from New England (Escaped CT in 2006, now living north of Tampa)
[ Post Reply | Private Reply | To 2 | View Replies]

To: Ham Hock

If we don’t do it nobody else will.

More and more I realize that the important matters are being left to the common people, because those who have the positions have no “sacred honor” to risk.

They will not risk their jobs or estates, which gives us greater evidence on how wonderful and principled the Founding Fathers were.


29 posted on 08/14/2010 8:22:00 AM PDT by Loud Mime (Argue from the Constitution: Initialpoints.net1)
[ Post Reply | Private Reply | To 10 | View Replies]

To: All

The hacks have been stopped or fixed. All three sites attacked are working now.


30 posted on 08/14/2010 8:40:11 AM PDT by kristinn (Since Jul 31, 1998)
[ Post Reply | Private Reply | To 1 | View Replies]

To: bert

America is controlled by the saudis and the saudi mole. TV networks - all of them helped and continue to help. the networks own ALL the channels.

Keep watching and supporting them. The public is so stupid.


31 posted on 08/14/2010 8:46:34 AM PDT by Frantzie (Television controls the American people/sheep)
[ Post Reply | Private Reply | To 5 | View Replies]

To: eleni121
Manning is in custody - why isn’t Julie?

Because he's a foreign national. As annoying as he may be, we can't simply run around the world applying US law to citizens of other countries in other countries.

Give this guy enough rope to hang himself with though and he eventually will.

32 posted on 08/14/2010 9:21:21 AM PDT by conimbricenses (Red means run son, numbers add up to nothing.)
[ Post Reply | Private Reply | To 9 | View Replies]

To: kristinn

bump


33 posted on 08/14/2010 9:31:28 AM PDT by tutstar
[ Post Reply | Private Reply | To 1 | View Replies]

To: library user

Well, just to be technical Afghans helping foreign soldiers operate within their own country could indeed qualify as treason... so I won’t fault the guy for claiming that Afghan-support of US operations is treason. {But then again, there are foreign members of Al Queda & the Taliban [IIRC] and helping those would, by the same token, be treason as well.}


34 posted on 08/14/2010 9:44:15 AM PDT by OneWingedShark (Q: Why am I here? A: To do Justly, to love mercy, and to walk humbly with my God.)
[ Post Reply | Private Reply | To 2 | View Replies]

To: soycd

>> WHy is this Asausage guy not in jail?

Apparently, it’s not that important. And stop calling him a sausage.


35 posted on 08/14/2010 9:54:51 AM PDT by Gene Eric (Your Hope has been redistributed. Here's your Change.)
[ Post Reply | Private Reply | To 8 | View Replies]

To: bert
He is an American enemy of the state [...]

Actually, he is an enemy of the American state.

36 posted on 08/14/2010 9:58:29 AM PDT by Gondring (Paul Revere would have been flamed as a naysayer troll and told to go back to Boston.)
[ Post Reply | Private Reply | To 5 | View Replies]

To: library user

An “off-target” JDAM works for me.... =.=


37 posted on 08/14/2010 10:26:10 AM PDT by cranked
[ Post Reply | Private Reply | To 2 | View Replies]

To: soycd

Because of the encrypted “Insurance” file on his site. If something happens to him the contents of the fill will be released.


38 posted on 08/14/2010 11:10:14 AM PDT by Lusis ("Underlying most arguments against the free market is a lack of belief in freedom itself.")
[ Post Reply | Private Reply | To 8 | View Replies]

To: Lusis

Fill=file


39 posted on 08/14/2010 11:10:51 AM PDT by Lusis ("Underlying most arguments against the free market is a lack of belief in freedom itself.")
[ Post Reply | Private Reply | To 38 | View Replies]

To: kristinn

Typical fascist liberals, they only like dissent for themselves.


40 posted on 08/14/2010 11:17:25 AM PDT by Free Vulcan (No prisoners, no mercy. 2010 is here...)
[ Post Reply | Private Reply | To 1 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041-49 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson