Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Russia Lies About Invading Ukraine as It Invades Ukraine
TDB ^ | 28 Aug 14 | Anna Nemtsova 

Posted on 08/29/2014 5:46:23 AM PDT by elhombrelibre

As Russia troops and tanks make an apparent bid to open the land route to annexed Crimea, discontent is growing in the motherland about the obvious but oft-denied war in Ukraine.

MOSCOW, Russia – Where U.S. President Barack Obama and German Chancellor Angela Merkel have failed to make Russian President Vladimir Putin acknowledge his ever-more-overt invasion of Ukraine and think about pulling back, Valentina Melnikova, the head of Russia’s famous Soldiers’ Mothers Committee, might just have a chance.

Early Thursday morning, Melnikova started getting phone calls from Russian army bosses. All of them, from the deputy defense minister to the paratrooper division commanders, wanted to meet with the great matriarch of the Russian military. She had accused the entire high command, along with Commander-in-Chief Vladimir Putin of invading Ukraine and of committing a crime against Russian citizens by sending Russian soldiers to "the bloody battlefields" without declaring the war, without signing legal papers with the servicemen, without letting Russian mothers know where exactly their drafted sons ended up dying.

The day before, Russian servicemen were fighting shoulder to shoulder with pro-Russian separatists in Novoazovsk, a strategic port city on the Russian border. By taking over Novoazovsk, the separatists cleared the way for more servicemen to pour into Ukraine. “According to our expert analyses,” said Melnikova – and few organizations have better information than hers – “ there are over 10,000 Russian soldiers fighting in Ukraine today."

(Excerpt) Read more at thedailybeast.com ...


TOPICS: Breaking News; Crime/Corruption; Foreign Affairs; Russia
KEYWORDS: novoazovsk; putin; russia; ukraine
Navigation: use the links below to view more comments.
first 1-5051-65 next last
Putin's not even fooling his own people anymore. Eventually some of his fans here will wake up.

“Russian public opinion, in fact, does not support the idea of invasion: the latest polls by the Moscow Public Opinion Foundation showed that only 5 per cent of Russians want the regular army to fight in Ukraine. But not many Russian citizens are ready to demonstrate against the war.”

1 posted on 08/29/2014 5:46:23 AM PDT by elhombrelibre
[ Post Reply | Private Reply | View Replies]

To: elhombrelibre

Nice to see that Baghdad Bob is working again.


2 posted on 08/29/2014 5:51:20 AM PDT by Slings and Arrows ("Your Daddy Was Drunk and Your Mama Was Lonely" - http://youtu.be/4HYy62qiOwA)
[ Post Reply | Private Reply | To 1 | View Replies]

To: elhombrelibre

Putin has learned how to lie well from obama, the LIAR in chief. I’m rather surprised putin hasn’t blamed his invasion on Bush.


3 posted on 08/29/2014 5:52:56 AM PDT by freeangel ( (free speech is only good until someone else doesn't like it)
[ Post Reply | Private Reply | To 1 | View Replies]

To: freeangel
I’m rather surprised putin hasn’t blamed his invasion on Bush.

Indirectly, I think he has. I've read he was upset and felt threatened by NATO's continued expansion eastward after the breakup of the old USSR.

4 posted on 08/29/2014 6:00:38 AM PDT by Pearls Before Swine
[ Post Reply | Private Reply | To 3 | View Replies]

To: elhombrelibre

IMHO he is just biding his time and waiting for Winter. He can then go without Euros longer than Europeans can go without heat, and everyone knows that. So the EU will get their gas when he gets the Ukraine.


5 posted on 08/29/2014 6:01:48 AM PDT by jdsteel (Give me freedom, not more government.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: elhombrelibre

If Barack won’t call it an invasion it must not be an invasion! Period!


6 posted on 08/29/2014 6:06:48 AM PDT by TexasCajun
[ Post Reply | Private Reply | To 1 | View Replies]

To: elhombrelibre
Putin's not even fooling his own people anymore. Eventually some of his fans here will wake up.

Did he learn that from us or did we learn that from him"

7 posted on 08/29/2014 6:21:03 AM PDT by Don Corleone ("Oil the gun..eat the cannoli. Take it to the Mattress.")
[ Post Reply | Private Reply | To 1 | View Replies]

To: Don Corleone
Eventually some of his fans here will wake up
Not going to happen. Malignant putinism is incurable. The only treatment is routinely administered by Ukrainian forces, but they are running out of the medicine.
8 posted on 08/29/2014 6:27:03 AM PDT by Samogon (Wise men talk because they have something to say; fools, because they have to say something. - Plato)
[ Post Reply | Private Reply | To 7 | View Replies]

To: Slings and Arrows
"E's not dead. E's just restin'."


9 posted on 08/29/2014 6:33:35 AM PDT by Bloody Sam Roberts ("A man should be prepared to be sufficient unto himself...")
[ Post Reply | Private Reply | To 2 | View Replies]

To: elhombrelibre

In Russia and America, the will of the people is irrelevant. The government will do as it damn well pleases and it’s up to the propagandists to sell it. Here, that’s the mission of the MSM.


10 posted on 08/29/2014 6:46:33 AM PDT by Spok ("What're you going to believe-me or your own eyes?" -Marx (Groucho))
[ Post Reply | Private Reply | To 1 | View Replies]

To: elhombrelibre
In my best voice Who knew? lol
11 posted on 08/29/2014 7:11:03 AM PDT by Phlap (REDNECK@LIBARTS.EDU)
[ Post Reply | Private Reply | To 1 | View Replies]

To: elhombrelibre

Russia acts like our own politicians. The difference is that Russia is being belligerent against a foreign nation and out politicians are being belligerent against the People.


12 posted on 08/29/2014 7:33:42 AM PDT by trebb (Where in the the hell has my country gone?)
[ Post Reply | Private Reply | To 1 | View Replies]

To: elhombrelibre
today one of my movement's activists Dmitry Monakhov went out to the Kremlin's walls to demand Putin stop his war in Ukraine. Police violently grabbed him and now Monakhov is facing a psychiatric exam. Any anti-war protester could either end up behind bars or in a psychiatric clinic, " Chirkova said

Good grief, it's not as if they were Tea Partiers or something.

13 posted on 08/29/2014 8:04:27 AM PDT by Madame Dufarge
[ Post Reply | Private Reply | To 1 | View Replies]

To: elhombrelibre

Like so many of these threads, if the posters don’t want to openly defend the new Soviet Putin, then they turn the thread into an anti-America thread, or anti-Obama thread as an indirect way of diluting or sidetracking criticism of the Russian goals they support.


14 posted on 08/29/2014 8:07:55 AM PDT by ansel12 (LEGAL immigrants, 30 million 1980-2012, continues to remake the nation's electorate for democrats)
[ Post Reply | Private Reply | To 1 | View Replies]

To: ansel12

You’re absolutely right. And by damning America, as if they were from the Reverend Wright’s church, these Putinistas show they’re more loyal to Putin than they are to the USA or to conservative values. I’m surprised they’re still allowed to be here, but that’s up to Jim.


15 posted on 08/29/2014 8:19:15 AM PDT by elhombrelibre (Against Obama. Against Putin. Pro-freedom. Pro-US Constitution.)
[ Post Reply | Private Reply | To 14 | View Replies]

To: trebb

I’m sure the dictator in Russia appreciates you clearing up the moral differences for them.


16 posted on 08/29/2014 8:20:27 AM PDT by elhombrelibre (Against Obama. Against Putin. Pro-freedom. Pro-US Constitution.)
[ Post Reply | Private Reply | To 12 | View Replies]

To: Madame Dufarge

Back in the USSR!


17 posted on 08/29/2014 8:51:07 AM PDT by GeronL (Vote for Conservatives not for Republicans)
[ Post Reply | Private Reply | To 13 | View Replies]

To: freeangel
Putin has learned how to lie well from obama, the LIAR in chief.

Former KGB Putin is a lifelong liar.

Historically it was the American left media and politicians that learned to lie from the KGB, and not the other way around.

18 posted on 08/29/2014 9:10:01 AM PDT by FreeReign
[ Post Reply | Private Reply | To 3 | View Replies]

To: jdsteel
MHO he is just biding his time and waiting for Winter. He can then go without Euros longer than Europeans can go without heat...

Russia loses Euros by not supplying Europe with heat.

It's a two-way street.

19 posted on 08/29/2014 9:15:09 AM PDT by FreeReign
[ Post Reply | Private Reply | To 5 | View Replies]

To: jdsteel

You said: “...IMHO he is just biding his time and waiting for Winter. He can then go without Euros longer than Europeans can go without heat, and everyone knows that. So the EU will get their gas when he gets the Ukraine...”

This is the point. I rather would send our European troops into the western Ukraine if they block the pipelines than defending their formal property in eastern Ukraine against the majority of the people (who are Russians) living there.

Regards from Europe

Andreas


20 posted on 08/29/2014 9:29:06 AM PDT by European Guest (De omnibus dubitandum)
[ Post Reply | Private Reply | To 5 | View Replies]

To: ansel12
Like so many of these threads, if the posters don’t want to openly defend the new Soviet Putin, then they turn the thread into an anti-America thread, or anti-Obama thread as an indirect way of diluting or sidetracking criticism of the Russian goals they support.

And then complain when they are called names.

21 posted on 08/29/2014 9:30:29 AM PDT by 1rudeboy
[ Post Reply | Private Reply | To 14 | View Replies]

To: elhombrelibre

And by damning America, as if they were from the Reverend Wright’s church, these Putinistas show they’re more loyal to Putin than they are to the USA


So we should go to war with Russia to prove our “loyalty?” Screw that. LET Putin have the Ukraine. The world didn’t stop going around when the USSR had it. Europe doesn’t give a damn if Russia takes it, so why should we waste lives and treasure over it?


22 posted on 08/29/2014 9:34:00 AM PDT by chessplayer
[ Post Reply | Private Reply | To 15 | View Replies]

To: chessplayer

I’m sure we can both agree that there is a difference between damning America and praising Putin’s immoral and illegal war on Ukraine, a country that has not provoked a war. And it’s simply absurd to think that the we either must go to war with Putin or damn American and praise Putin.


23 posted on 08/29/2014 9:55:10 AM PDT by elhombrelibre (Against Obama. Against Putin. Pro-freedom. Pro-US Constitution.)
[ Post Reply | Private Reply | To 22 | View Replies]

To: Slings and Arrows

OH Man I miss that guy Baghdad Bob whatever happen to him now I understand he went to Russia LOL!


24 posted on 08/29/2014 9:57:02 AM PDT by SevenofNine (We are Freepers, all your media bases belong to us ,resistance is futile)
[ Post Reply | Private Reply | To 2 | View Replies]

To: elhombrelibre

I have not seen one person say we should go to war with Russia. I am very much in favor of helping Ukraine and sending them new weapons and equipment. I even opposed the “sanctions/trade war” with Russia as stupid, it does nothing to help Ukraine.


25 posted on 08/29/2014 9:57:25 AM PDT by GeronL (Vote for Conservatives not for Republicans)
[ Post Reply | Private Reply | To 23 | View Replies]

To: GeronL

I agree. That’s a red herring stated to imply that there is no alternative to appeasement and letting the bully have his way. A lot of the sophistries we read in support of Putin are really weak.


26 posted on 08/29/2014 10:03:31 AM PDT by elhombrelibre (Against Obama. Against Putin. Pro-freedom. Pro-US Constitution.)
[ Post Reply | Private Reply | To 25 | View Replies]

FReepers, Let's go!
Everyone needs to donate.


All contributions are for the current quarter expenses.


27 posted on 08/29/2014 10:07:33 AM PDT by RedMDer (May we always be happy and may our enemies always know it. - Sarah Palin, 10-18-2010)
[ Post Reply | Private Reply | View Replies]

To: chessplayer

Who told you Europe/NATO doesn’t care about Russia taking Ukraine?


28 posted on 08/29/2014 10:30:12 AM PDT by ansel12 (LEGAL immigrants, 30 million 1980-2012, continues to remake the nation's electorate for democrats)
[ Post Reply | Private Reply | To 22 | View Replies]

To: elhombrelibre
I think what's worse is the invasion that our administration insists isn't taking place that is taking place.
29 posted on 08/29/2014 10:37:17 AM PDT by BradyLS (DO NOT FEED THE BEARS!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: chessplayer

I’m with you. No use losing any sleep over Russia’s steady re-annexation of Ukraine if our own elites can’t be bothered about Mexico’s steady re-annexation of the American Southwest.


30 posted on 08/29/2014 10:42:55 AM PDT by BradyLS (DO NOT FEED THE BEARS!)
[ Post Reply | Private Reply | To 22 | View Replies]

To: elhombrelibre

Instead of creating WWIII Putin should have worked on Russia’s economy which would have helped his people. This little man is just as insane as Hitler was and he eventually will put Russia in the trash heap. This little man says he has nukes? What? Damn what a stupid nitwit. Most of the damn world has them and what does this idiot think our armament is?


31 posted on 08/29/2014 11:35:44 AM PDT by Logical me
[ Post Reply | Private Reply | To 1 | View Replies]

To: SevenofNine

He’s in good form, too.


32 posted on 08/29/2014 1:21:59 PM PDT by Slings and Arrows ("Your Daddy Was Drunk and Your Mama Was Lonely" - http://youtu.be/4HYy62qiOwA)
[ Post Reply | Private Reply | To 24 | View Replies]

To: Slings and Arrows

Baghdad Bob is best thing during Iraqi war

He was good I wonder why he never sign with US network that be so cool better than Brian William sometime


33 posted on 08/29/2014 1:57:32 PM PDT by SevenofNine (We are Freepers, all your media bases belong to us ,resistance is futile)
[ Post Reply | Private Reply | To 32 | View Replies]

To: SevenofNine

The other talking heads would be jealous of his mad skillz.


34 posted on 08/29/2014 2:04:04 PM PDT by Slings and Arrows ("Your Daddy Was Drunk and Your Mama Was Lonely" - http://youtu.be/4HYy62qiOwA)
[ Post Reply | Private Reply | To 33 | View Replies]

To: elhombrelibre
What?
Commies NEVER lie.
Period!!!
35 posted on 08/29/2014 2:41:52 PM PDT by Amagi (Lenin: "Socialized Medicine is the Keystone to the Arch of the Socialist State.")
[ Post Reply | Private Reply | To 1 | View Replies]

To: elhombrelibre
Russia Lies About Invading Ukraine as It Invades Ukraine

Obama Lies About Defending Our Border As He Works On Amnesty For All

36 posted on 08/29/2014 9:10:25 PM PDT by OrangeHoof (Every time you say no to a liberal, you make the Baby Barack cry.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: OrangeHoof

I always find responses like yours just plain weird. I know Obama lies. Why does that make it okay for Putin to lie about invading a country because Obama lies about defending our border? I’m not trying to achieve utopia by saying one lie doesn’t make the other acceptable. Like your mother probably told you, “Two wrongs don’t make a right.”


37 posted on 08/29/2014 11:34:39 PM PDT by elhombrelibre (Against Obama. Against Putin. Pro-freedom. Pro-US Constitution.)
[ Post Reply | Private Reply | To 36 | View Replies]

To: elhombrelibre; SunkenCiv; gandalftb; nuconvert; TigerLikesRooster; Greetings_Puny_Humans; GeronL; ..
This will work:

U.K. Wants EU to Block Russia From SWIFT Banking Network http://www.bloomberg.com/news/2014-08-29/u-k-wants-eu-to-block-russia-from-swift-banking-network.html

and increase the oil production:

The main cause for the recent fall in oil prices is that weakening demand is being met by rising production. West African crude exports to Asia were near record levels in September, a Reuters survey of traders showed, and the North Sea market remained well supplied.

Production from the Organization of the Petroleum Exporting Countries (OPEC) rose, despite conflicts in Iraq and Libya.
OPEC, which supplies a third of the world's oil, raised its output in August from July, with higher supply from Libya, Angola and Iran, a Reuters survey found.

http://www.dailytimes.com.pk/business/30-Aug-2014/brent-oil-rises-on-ukraine-crisis-but-heads-for-monthly-fall

the result will be this:

“With the significant deterioration in the Ukrainian situation, markets may treat this as a Lehman-style shock,” Kantarovich wrote in an e-mailed report Friday. “Revisiting the post-Lehman lows would imply downside of 50 percent from an index perspective.”

The bank recommends reducing Russian investments because “markets may no longer assume a quick and easy resolution of the conflict and ‘worse before better’ seems a likely sequence.”

http://www.Newsmax.com/Finance/JPMorgan-Russia-Ukraine-stocks/2014/08/29/id/591641

38 posted on 08/30/2014 2:03:39 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: elhombrelibre
I’m sure the dictator in Russia appreciates you clearing up the moral differences for them

And I'm sure the dictator in the WH appreciates you taking that slant on my comment.

39 posted on 08/30/2014 2:22:01 AM PDT by trebb (Where in the the hell has my country gone?)
[ Post Reply | Private Reply | To 16 | View Replies]

To: elhombrelibre

Why should we care that other leaders lie when our own leaders are worse?


40 posted on 08/30/2014 7:41:38 AM PDT by OrangeHoof (Every time you say no to a liberal, you make the Baby Barack cry.)
[ Post Reply | Private Reply | To 37 | View Replies]

To: BradyLS

.....” No use losing any sleep over Russia’s steady re-annexation of Ukraine if our own elites can’t be bothered about Mexico’s steady re-annexation of the American Southwest”......

That’s how I see it...like calling the Kettle black sort of thing.


41 posted on 08/30/2014 9:37:31 AM PDT by caww
[ Post Reply | Private Reply | To 30 | View Replies]

To: BradyLS
No use losing any sleep over Russia’s steady re-annexation of Ukraine if our own elites can’t be bothered about Mexico’s steady re-annexation of the American Southwest.

I'd like to know, What is the Ukrainian government doing to ensure that the newly arriving Russian "Dreamers" have access to free education and health care?

42 posted on 08/30/2014 10:00:20 AM PDT by kevao (Biblical Jesus: Give your money to the poor. Socialist Jesus: Give your neighbor's money to the poor)
[ Post Reply | Private Reply | To 30 | View Replies]

To: AdmSmith; AnonymousConservative; Berosus; bigheadfred; Bockscar; cardinal4; ColdOne; ...

Thanks AdmSmith.


43 posted on 08/30/2014 12:16:06 PM PDT by SunkenCiv (https://secure.freerepublic.com/donate/)
[ Post Reply | Private Reply | To 38 | View Replies]

To: SunkenCiv

Not just what Putin ordered:

Kazakh Pres says Kazakhstan may leave EurasianUnion if interests infringed

http://en.tengrinews.kz/politics_sub/Kazakhstan-may-leave-EEU-if-its-interests-are-infringed-Nazarbayev-255722/


44 posted on 08/30/2014 12:24:54 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 43 | View Replies]

To: AdmSmith; AnonymousConservative; Berosus; bigheadfred; Bockscar; cardinal4; ColdOne; ...

Body bags. That’s what drove the paleoSoviet Red Army out of Afghanistan.

During the Nixon years, there were self-organized “soldiers’ union” cells within the Red Army, pushing for better conditions and pushing against the various internecine internal conflicts going on inside the USSR. A merc who grew up around here actually worked inside Soviet territory, along with a bunch of others, because the dictatorship couldn’t trust the troops to fire on citizens.

The war in Afghanistan happened to fit the longterm strategy of Soviet containment of China, and put them within a step of a year-round warm-water port at last. But the overriding reason was to put the Red Army to work shooting non-citizens and cutting off supply routes for the various independence movements starting up in the muzzie ‘stans that were then part of the USSR.

> Valentina Melnikova, the head of Russia’s famous Soldiers’ Mothers Committee... started getting phone calls from Russian army bosses... She had accused the entire high command, along with Commander-in-Chief Vladimir Putin of invading Ukraine and of committing a crime against Russian citizens by sending Russian soldiers to “the bloody battlefields” without declaring the war, without signing legal papers with the servicemen, without letting Russian mothers know where exactly their drafted sons ended up dying.

Thanks elhombrelibre.


45 posted on 08/30/2014 12:31:35 PM PDT by SunkenCiv (https://secure.freerepublic.com/donate/)
[ Post Reply | Private Reply | View Replies]

http://widerhorizons.ca/wp-content/uploads/2013/04/.jpg


46 posted on 08/30/2014 12:35:10 PM PDT by SunkenCiv (https://secure.freerepublic.com/donate/)
[ Post Reply | Private Reply | View Replies]

To: ansel12; elhombrelibre

/bingo


47 posted on 08/30/2014 12:36:22 PM PDT by SunkenCiv (https://secure.freerepublic.com/donate/)
[ Post Reply | Private Reply | To 14 | View Replies]

To: SunkenCiv
Kazakhstan next?

Anna Sazonova, a student of the People's Friendship University of Russia expressed concern over escalating nationalism in Ukraine and asked whether a similar scenario could unfold in Kazakhstan if Mr. Nazarbayev left his presidential post. “There are concerns over growing nationalist sentiments in Kazakhstan’s south. And the incumbent president Nursultan Nazarbayev seem to be the only deferring factor. Should we expect a Ukraine-like scenario if the President steps down? Has Russia got a strategy to deal with this possible scenario? And what are the prospects of Eurasian integration (and joining of the two countries together)?” she asked President Putin at the forum.

“Kazakhstan is ten-fold smaller than Russia in terms of population, but it is still a big country. And I am confident that a majority of its population supports development of close ties with Russia.

http://en.tengrinews.kz/politics_sub/President-Vladimir-Putin-of-Russia-on-Kazakhstan-and-its-future-255793/

48 posted on 08/30/2014 12:53:20 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 47 | View Replies]

To: trebb

I don’t care what Obama thinks. I don’t care what Putin thinks either. I would like to think that any conservative American would oppose both of them and not think that the abuse of power by one of them negates the abuse of power by the other. Or to put it another way, “Two wrongs don’t make a right.” Perhaps your parents shared that truism with you like mine did with me. Putin and Obama are both at best wrong head and at worst evil. If I cannot convince you that Putin’s a bad man, please don’t try to tell me Obama’s bad policies or wicked ways make Putin’s okay. I’m against both and neither of them fools me and neither is conservative.


49 posted on 08/30/2014 1:19:09 PM PDT by elhombrelibre (Against Obama. Against Putin. Pro-freedom. Pro-US Constitution.)
[ Post Reply | Private Reply | To 39 | View Replies]

To: AdmSmith; AnonymousConservative; Berosus; bigheadfred; Bockscar; cardinal4; ColdOne; ...

When the USSR broke under its own weight — thank you Presidents Reagan and Bush — the Russians were glad to get out of those ‘stan SSRs at last, and everyone there who wasn’t transplanted Russian, Korean, etc etc, was glad to see them go. The only Russian interest in Kazakhstan is the space rocket launch facility.


50 posted on 08/30/2014 1:31:51 PM PDT by SunkenCiv (https://secure.freerepublic.com/donate/)
[ Post Reply | Private Reply | To 48 | View Replies]


Navigation: use the links below to view more comments.
first 1-5051-65 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson