Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Islamist blitzkrieg in Syria: Jihadists wiping out moderate rebels
RT ^ | Sept 19, 2013 | RT Staff

Posted on 09/21/2013 10:05:33 PM PDT by Innovative

click here to read article


Navigation: use the links below to view more comments.
first 1-2021 next last
Syria is not a place where we should get involved... for obvious reasons.
1 posted on 09/21/2013 10:05:34 PM PDT by Innovative
[ Post Reply | Private Reply | View Replies]

To: Innovative
Lebanon, Syria, Jordan ---> Jihadists.

Bammy supports MuzzieBros et. al.

2 posted on 09/21/2013 10:09:11 PM PDT by Paladin2 (h)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Innovative

A Muslim moderate-is that like a Communist or Nazi moderate?


3 posted on 09/21/2013 10:09:22 PM PDT by fortheDeclaration (Pr 14:34 Righteousness exalteth a nation:but sin is a reproach to any people)
[ Post Reply | Private Reply | To 1 | View Replies]

>> radical Islamists are seeking ultimate authority to fight Assad.

And it’s been only 12 years...


4 posted on 09/21/2013 10:09:42 PM PDT by Gene Eric (Don't be a statist!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Innovative
Well, the Islamicists gotta kill the “democratic” rebels to get the fancy weapons Obama and the CIA has been sending ‘em, whatta ya expect?
5 posted on 09/21/2013 10:12:39 PM PDT by Navy Patriot (Join the Democrats, it's not Fascism when WE do it, and the Constitution and law mean what WE say.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Innovative

The lit match called Obama just can’t help himself by forcing his way into a room full of gasoline.


6 posted on 09/21/2013 10:14:01 PM PDT by blackdog (There is no such thing as healing, only a balance between destructive and constructive forces.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Navy Patriot

So it’s a sort of Benghazi raid, only in Syria.


7 posted on 09/21/2013 10:15:34 PM PDT by blackdog (There is no such thing as healing, only a balance between destructive and constructive forces.)
[ Post Reply | Private Reply | To 5 | View Replies]

To: Innovative
" Al-Qaeda jihadists as the only remaining force capable of opposing President Bashar Assad."

And what is the reason we need Assad ousted? I smell a rat. Who's got some sort of planned use for Syria's infrastructure, waterways, pipelines, or minerals? Who benefits from Assad's removal, only to be replaced by Al-Qaeda / Taliban / Jihadi radicals?

8 posted on 09/21/2013 10:20:31 PM PDT by blackdog (There is no such thing as healing, only a balance between destructive and constructive forces.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: blackdog

‘And what is the reason we need Assad ousted?’

Same reason we wanted to oust Mubarak — to help the jihadists to take over...


9 posted on 09/21/2013 10:28:31 PM PDT by Innovative ("Winning isn't everything, it's the only thing." -- Vince Lombardi)
[ Post Reply | Private Reply | To 8 | View Replies]

To: Innovative
Tell our president if he wants to relive his teen years madrass experiences in Pakistan and Indonesia, he should just get some post cards. He’s like the jackass going back to his high school reunion as a the unequaled king of success, wanting to impress his former peers. He might even arrive by two helicopters. One for him and one for his dog.
10 posted on 09/21/2013 10:34:42 PM PDT by blackdog (There is no such thing as healing, only a balance between destructive and constructive forces.)
[ Post Reply | Private Reply | To 9 | View Replies]

To: blackdog
So it’s a sort of Benghazi raid, only in Syria.

Yep, the goal is to arm and fund Al Queda, so it's Mission Accomplished!

11 posted on 09/21/2013 10:48:00 PM PDT by Navy Patriot (Join the Democrats, it's not Fascism when WE do it, and the Constitution and law mean what WE say.)
[ Post Reply | Private Reply | To 7 | View Replies]

To: AdmSmith; AnonymousConservative; Berosus; bigheadfred; Bockscar; cardinal4; ColdOne; ...

Thanks Innovative.
Al-Qaeda-linked jihadists in Syria have begun an offensive against former allies, wrestling moderate FSA rebels out of the controlled areas.
This has been going on since the Assad regime brought on the civil war by firing the first shots.


12 posted on 09/21/2013 11:05:13 PM PDT by SunkenCiv (It's no coincidence that some "conservatives" echo the hard left.)
[ Post Reply | Private Reply | View Replies]

To: blackdog

He might even arrive by two helicopters. One for him and one for his dog.

Right, his wife would have to be delivered by truck.


13 posted on 09/21/2013 11:21:36 PM PDT by tet68 ( " We would not die in that man's company, that fears his fellowship to die with us...." Henry V.)
[ Post Reply | Private Reply | To 10 | View Replies]

To: ScaniaBoy; annieokie; penelopesire; maggief; Protect the Bill of Rights; thouworm; SE Mom; ...
Different country, same al qaeda. They MUST have blood.

This is a combined potpurri list. Anyone wanting on or off please advise.


14 posted on 09/22/2013 2:01:22 AM PDT by MestaMachine (My caps work, You gotta earn them.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Innovative

I wonder how many American supplied weapons are already being used by Al Qaeda and its allies in their offensive?


15 posted on 09/22/2013 2:48:13 AM PDT by Truth29
[ Post Reply | Private Reply | To 1 | View Replies]

To: Innovative; blackdog

‘And what is the reason we need Assad ousted?’

0muslim’s financing and advancement of the islamic caliphate.


16 posted on 09/22/2013 2:54:09 AM PDT by Carriage Hill (Peace is that brief glorious moment in history, when everybody stands around reloading.)
[ Post Reply | Private Reply | To 9 | View Replies]

To: carriage_hill
"0muslim’s financing and advancement of the islamic caliphate.:

Bingo! Obama's every action advances Islamic radicalism and transnational terrorist groups. He topples secular dictators to clear the way for the Muslim Brotherhood and other Islamists.

17 posted on 09/22/2013 4:07:15 AM PDT by Truth29
[ Post Reply | Private Reply | To 16 | View Replies]

To: fortheDeclaration
A Muslim moderate-is that like a Communist or Nazi moderate?

I think a Muslim moderate tries to use a clean, sharpened sword to cut your head off, rather than an old rusty one.

18 posted on 09/22/2013 4:57:58 AM PDT by COBOL2Java (I'm a Christian, pro-life, pro-gun, Reaganite. The GOP hates me. Why should I vote for them?)
[ Post Reply | Private Reply | To 3 | View Replies]

To: Innovative

Friends of zero, McCain, Graham, Burr, Corker.....


19 posted on 09/22/2013 5:37:31 AM PDT by rrrod (at home in Medellin Colombia)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Innovative; SunkenCiv; nuconvert

This might or might not be true as the source is http://en.wikipedia.org/wiki/Rt.com that is part of the Russian government. With respect to developments in Syria they are working full time in spinning the Soviet view.


20 posted on 09/22/2013 9:36:14 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]


Navigation: use the links below to view more comments.
first 1-2021 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson