Syria is not a place where we should get involved... for obvious reasons.
To: Innovative
Lebanon, Syria, Jordan ---> Jihadists.
Bammy supports MuzzieBros et. al.
2 posted on
09/21/2013 10:09:11 PM PDT by
Paladin2
(h)
To: Innovative
A Muslim moderate-is that like a Communist or Nazi moderate?
3 posted on
09/21/2013 10:09:22 PM PDT by
fortheDeclaration
(Pr 14:34 Righteousness exalteth a nation:but sin is a reproach to any people)
>> radical Islamists are seeking ultimate authority to fight Assad.
And it’s been only 12 years...
4 posted on
09/21/2013 10:09:42 PM PDT by
Gene Eric
(Don't be a statist!)
To: Innovative
Well, the Islamicists gotta kill the “democratic” rebels to get the fancy weapons Obama and the CIA has been sending ‘em, whatta ya expect?
5 posted on
09/21/2013 10:12:39 PM PDT by
Navy Patriot
(Join the Democrats, it's not Fascism when WE do it, and the Constitution and law mean what WE say.)
To: Innovative
The lit match called Obama just can’t help himself by forcing his way into a room full of gasoline.
6 posted on
09/21/2013 10:14:01 PM PDT by
blackdog
(There is no such thing as healing, only a balance between destructive and constructive forces.)
To: Innovative
" Al-Qaeda jihadists as the only remaining force capable of opposing President Bashar Assad."
And what is the reason we need Assad ousted? I smell a rat. Who's got some sort of planned use for Syria's infrastructure, waterways, pipelines, or minerals? Who benefits from Assad's removal, only to be replaced by Al-Qaeda / Taliban / Jihadi radicals?
8 posted on
09/21/2013 10:20:31 PM PDT by
blackdog
(There is no such thing as healing, only a balance between destructive and constructive forces.)
To: ScaniaBoy; annieokie; penelopesire; maggief; Protect the Bill of Rights; thouworm; SE Mom; ...
Different country, same al qaeda. They MUST have blood.
This is a combined potpurri list. Anyone wanting on or off please advise.
14 posted on
09/22/2013 2:01:22 AM PDT by
MestaMachine
(My caps work, You gotta earn them.)
To: Innovative
I wonder how many American supplied weapons are already being used by Al Qaeda and its allies in their offensive?
15 posted on
09/22/2013 2:48:13 AM PDT by
Truth29
To: Innovative
Friends of zero, McCain, Graham, Burr, Corker.....
19 posted on
09/22/2013 5:37:31 AM PDT by
rrrod
(at home in Medellin Colombia)
To: Innovative; SunkenCiv; nuconvert
This might or might not be true as the source is http://en.wikipedia.org/wiki/Rt.com that is part of the Russian government. With respect to developments in Syria they are working full time in spinning the Soviet view.
20 posted on
09/22/2013 9:36:14 AM PDT by
AdmSmith
(GCTGATATGTCTATGATTACTCAT)
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson