Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

This Is What Benghazi ‘Consulate’ Really Was
KleinOnline ^ | Oct. 17, 2012 | Aaron Klein

Posted on 10/24/2012 8:10:59 PM PDT by Dajjal

click here to read article


Navigation: use the links below to view more comments.
first previous 1-2021-4041-44 next last
To: LucyT

ping


21 posted on 10/24/2012 10:27:40 PM PDT by Fractal Trader
[ Post Reply | Private Reply | To 1 | View Replies]

To: Fractal Trader; penelopesire; MestaMachine; KC_Lion; Godzilla; Domestic Church; dragonblustar; ...

*
*

Article, then # 4 , # 19.

Thanks, Fractal Trader.

.


22 posted on 10/24/2012 11:08:39 PM PDT by LucyT
[ Post Reply | Private Reply | To 21 | View Replies]

To: Paladin2
So it was mostly a CIA operation not unlike Iran-Contra.

At least Iran Contra had the goal of obtaining the release of 7 American hostages - can't find anything remotely pro-American in this deal.

23 posted on 10/25/2012 2:57:57 AM PDT by trebb (Allies no longer trust us. Enemies no longer fear us.)
[ Post Reply | Private Reply | To 3 | View Replies]

To: chris37

24 posted on 10/25/2012 3:17:59 AM PDT by Fresh Wind (If Obama is an empty chair, then Biden is the whoopee cushion.)
[ Post Reply | Private Reply | To 14 | View Replies]

To: Fresh Wind; mickie
Wow, he sure does have the stink-eye, doesn't he!

I just rubbed some old-world garlic across my computer screen.

Leni

25 posted on 10/25/2012 3:38:50 AM PDT by MinuteGal
[ Post Reply | Private Reply | To 24 | View Replies]

To: MinuteGal

Two evil faces. One was just an actor, one is the president.


26 posted on 10/25/2012 3:41:59 AM PDT by Fresh Wind (If Obama is an empty chair, then Biden is the whoopee cushion.)
[ Post Reply | Private Reply | To 25 | View Replies]

To: WilliamofCarmichael

Even if Russia was behind the Benghazi attack they are still doing a better job of working for US interests than the Obama administration is.


27 posted on 10/25/2012 4:14:54 AM PDT by freedomfiter2 (Brutal acts of commission and yawning acts of omission both strengthen the hand of the devil.)
[ Post Reply | Private Reply | To 13 | View Replies]

To: hoosiermama; penelopesire; thouworm; Protect the Bill of Rights; LucyT; SE Mom; MestaMachine; ...

More CYA ... but maybe some relevant facts. Does it seem she was assuming Stevens was kidnapped??

http://online.wsj.com/article/SB10000872396390443684104578066631931377740.html

(snip)

In the Benghazi crisis, she made a previously undisclosed call to Libyan President Mohammed Magarief seeking immediate help in finding the missing U.S. ambassador,

(snip)

Then on Sept. 11, the State Department at 4 p.m. received an alert from its Libyan embassy in Tripoli. The U.S. ambassador, Mr. Stevens, visiting the Benghazi consulate, had delivered a one-sentence message: “We’re under attack.”

At 4:20 p.m., State Department executive secretary Steve Mull alerted Mrs. Clinton in her office. According to a person present, Mrs. Clinton asked, “How are we getting more security on the ground? More communication on the ground?”

And she said: “Find Chris,” the U.S. ambassador. She had handpicked him for the posting.

At 5 p.m., Mr. Mull informed her that they couldn’t locate the ambassador or reach his cellphone. But he said the department’s “Ops Center” had an open line with the Tripoli embassy. Mrs. Clinton moved there for a video conference with White House, military and intelligence officials, who ordered increased security regionwide. Mrs. Clinton remained at the State Department until midnight.

Overnight, Mr. Stevens’ body was identified at a Benghazi hospital. Mrs. Clinton returned to the State Department at 7 the next morning to inform the world of the tragedy.

(snip)

+++++++++++++++++++++++++++++++++++++++

http://www.state.gov/r/pa/prs/appt/2012/09/197186.htm

Public Schedule for September 11, 2012

U.S. DEPARTMENT OF STATE
PUBLIC SCHEDULE
TUESDAY SEPTEMBER 11, 2012

SECRETARY HILLARY RODHAM CLINTON

9:20 a.m. Secretary Clinton meets with the Fulbright Foreign Scholarship Board, at the Department of State.
(CLOSED PRESS COVERAGE)

10:15 a.m. Secretary Clinton holds a swearing-in ceremony for U.S. Ambassador to Ghana Gene Cretz, at the Department of State.
(CLOSED PRESS COVERAGE)

12:00 p.m. Secretary Clinton meets with Secretary of Defense Leon Panetta and National Security Adviser Tom Donilon, at the White House.
(MEDIA DETERMINED BY WHITE HOUSE)

2:15 p.m. Secretary Clinton attends the Flag Ceremony for Cameron Munter, at the Department of State.
(CLOSED PRESS COVERAGE)

4:00 p.m. Secretary Clinton holds a swearing-in ceremony for U.S. Ambassador to Serbia Michael Kirby, at the Department of State.
(CLOSED PRESS COVERAGE)

http://www.whitehouse.gov/schedule/complete/2012-09-11

5:00 pm
The President and the Vice President meet with Secretary of Defense
Oval Office
Closed Press

http://articles.boston.com/2012-09-12/world/33776446_1_benghazi-revolt-against-libyan-leader-president-barack-obama

“Obama was informed about the developments in Libya by his National Security Adviser Tom Donilon as the president began a weekly meeting Secretary of Defense Leon Panetta and Chairman of the Joint Chiefs of Staff Martin Dempsey. The White House said Obama was kept apprised throughout the evening and then again Wednesday morning.”


28 posted on 10/25/2012 4:27:16 AM PDT by maggief
[ Post Reply | Private Reply | To 1 | View Replies]

To: Dajjal
Obama can make the discussion about almost anything - he's kept the FBI out of Benghizi - on the bulls*it excuse that it's ‘too dangerous’.

Of course CNN’s been to Benghazi since the slaughter - combing the place down - same with FOX News. Obama's either an idiot, or he's covering something up or he's planting a new story.... maybe something to be accidentally ‘leaked’ to the New York Times a few days before the election? It's hard to believe he and Hillary would be able to turn down cries for help for over 5 hours - especially with so many groups ready to go in and save these people - unless that had a plausible excuse. Or something that sounded plausible... something that would keep everyone in line.

If the excuse was a lie (to help with his reelection) - meant to be a trap for those who would naturally condemn the killing and rape of four Americans, then he's a monster. Obama's not good at running the country - unless the goal is to destroy what we have - but he is good at protecting himself. Lying isn't an issue for him. Look at the Letterman and GM lie - one that's gone on forever. No guilt or hesitation... Lost my train of thought - - anyhow I'll feel relieved when the election's over and the Benghazi mess can be looked at with honest eyes...

29 posted on 10/25/2012 4:44:03 AM PDT by GOPJ (Obama on Benghazi - - http://www.youtube.com/watch?v=nE-aorbApBw&feature=plcp)
[ Post Reply | Private Reply | To 4 | View Replies]

To: maggief

Nobody mentions petraeus. You can’t connect all the dots on this if you don’t have all the dots. petraeus is into this up to his eyeballs...and it isn’t the first time.


30 posted on 10/25/2012 6:50:10 AM PDT by MestaMachine (obama kills and none dare call it treason)
[ Post Reply | Private Reply | To 28 | View Replies]

To: MestaMachine

bttt


31 posted on 10/25/2012 7:04:42 AM PDT by ConservativeMan55
[ Post Reply | Private Reply | To 30 | View Replies]

To: MestaMachine

Same with this guy.

http://bangordailynews.com/2012/10/25/politics/a-cia-veteran-transforms-u-s-counterterrorism-policy/?ref=latest


32 posted on 10/25/2012 7:09:26 AM PDT by maggief
[ Post Reply | Private Reply | To 30 | View Replies]

To: maggief

Wow. In this article, I couldn’t tell if it was a profile or if they were nominating this bastich for sainthood.


33 posted on 10/25/2012 7:25:13 AM PDT by MestaMachine (obama kills and none dare call it treason)
[ Post Reply | Private Reply | To 32 | View Replies]

To: chris37
No sympathy is due for that devil.

Obama had to know and approve of the idea of running arms to radical Islamists in league with the Muslim Brotherhood and al Qaeda in order to help overthrow regimes in Libya and Syria. Allowing Ambassador Stevens and others to die in order to cover up their complicity in that scheme was pure evil. Worse: Hillary Clinton knows the truth and refuses to speak. And worse than that: so does General Petraeus.

34 posted on 10/25/2012 7:29:55 AM PDT by andy58-in-nh (Cogito, ergo armatum sum.)
[ Post Reply | Private Reply | To 14 | View Replies]

To: MestaMachine

Unreal, isn’t it?

Then there’s the WSJ HRC report I posted above. MSM is putting lipstick on the pigs.


35 posted on 10/25/2012 7:43:38 AM PDT by maggief
[ Post Reply | Private Reply | To 33 | View Replies]

To: andy58-in-nh
Obama had to know and approve of the idea of running arms to radical Islamists

But who's idea was it originally? We need that person named and everyone down the line who went along with it.

I will always blame the GOP for everything that's been done the last four years. They failed to vet him and they knew yet "evaded" the situation at each and every turn.

36 posted on 10/25/2012 7:58:18 AM PDT by bgill (Evil doers are in every corner of our government. Have we passed the time of no return?)
[ Post Reply | Private Reply | To 34 | View Replies]

To: maggief; MestaMachine

” “Ever since the first couple of months, I felt there was a real similarity of views that gave me a sense of comfort,” Brennan said. “I don’t think we’ve had a disagreement.””

Of course there was no disagreement, Brennan. How could a dummy like Obama disagree with that which he can’t understand to begin with ?

Brennan is a bad liar as well.


37 posted on 10/25/2012 8:57:19 AM PDT by stephenjohnbanker ((God, family, country, mom, apple pie, the girl next door and a Ford F250 to pull my boat.))
[ Post Reply | Private Reply | To 32 | View Replies]

To: maggief

Don’t subscribe to WSJ.

1) Do you have another link to the full article?
2) Are there any additional time/hour points in WSJ article?


38 posted on 10/25/2012 10:49:02 AM PDT by thouworm (.)
[ Post Reply | Private Reply | To 28 | View Replies]

To: gandalftb

ping


39 posted on 10/25/2012 1:45:28 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Dajjal; Cronos; no-to-illegals; cradle of freedom; Eleutheria5

Thanks for the ping.
Unsurprising.
The ‘jihadist’, ‘mujahedin’, ‘islamist’ support has been going on for over 3 decades in the ME, North Africa and generally the muslim world.
I continue to say: don’t forget Jimmy Carter and Brzezinski’s doctrine of “Islamic Green Belt”. That was just a start. Very dangerous stuff.
When you make deals with the Devil, sooner or later he will come to collect.


40 posted on 10/25/2012 5:51:44 PM PDT by odds
[ Post Reply | Private Reply | To 8 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041-44 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson