Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

This Is What Benghazi ‘Consulate’ Really Was
KleinOnline ^ | Oct. 17, 2012 | Aaron Klein

Posted on 10/24/2012 8:10:59 PM PDT by Dajjal

The U.S. diplomatic mission in Benghazi, Libya, actually served as a meeting place to coordinate aid for the rebel-led insurgencies in the Middle East, according to Middle Eastern security officials.

Among the tasks performed inside the building was collaborating with Arab countries on the recruitment of fighters – including jihadists – to target Bashar al-Assad’s regime in Syria.

The distinction may help explain why there was no major public security presence at what has been described as a “consulate.” Such a presence would draw attention to the shabby, nondescript building that was allegedly used for such sensitive purposes.

[snip]

The security officials divulged the building was routinely used by Stevens and others to coordinate with the Turkish, Saudi and Qatari governments on supporting the insurgencies in the Middle East, most prominently the rebels opposing Assad’s regime in Syria.

[snip]

Stevens served as a key contact with the Saudis to coordinate the recruitment by Saudi Arabia of Islamic fighters from North Africa and Libya. The jihadists were sent to Syria via Turkey to attack Assad’s forces, said the security officials.

[snip]

In August, KleinOnline quoted a senior Syrian source claiming at least 500 hardcore mujahedeen from Afghanistan, many of whom were spearheading efforts to fight the U.S. there, were killed in clashes with Syrian forces last month.

Also last month, KleinOnline reported Jihadiya Salafia in the Gaza Strip, a group that represents al-Qaida in the coastal territory, had declared three days of mourning for its own jihadists who died in Syria in recent weeks.

[snip]

(Excerpt) Read more at kleinonline.wnd.com ...


TOPICS: Foreign Affairs; News/Current Events; Politics/Elections; War on Terror
KEYWORDS: 2012; 20120911; aaronklein; alqaeda; alqaida; aq; bengazi; benghazi; benghazigate; cia; consulate; election; islam; jihad; kenyanbornmuzzie; klein; libya; muslimbrotherhood; obama; romney; rop; shadowwars; stevens; syria; talkradio; threatmatrix; waronterror; whirlednutdaily; wot
Audio from Aaron Klein's Oct. 21 radio program:

http://kleinonline.wnd.com/audio/game-changer-what-really-happened-in-benghazi-part-i/

http://kleinonline.wnd.com/audio/game-changer-what-really-happened-in-benghazi-part-ii/

1 posted on 10/24/2012 8:11:02 PM PDT by Dajjal
[ Post Reply | Private Reply | View Replies]

To: Dajjal

two thoughts come to mind:

Play with fire, and you will get burned

Fallacy of Control


2 posted on 10/24/2012 8:13:13 PM PDT by PGR88
[ Post Reply | Private Reply | To 1 | View Replies]

To: Dajjal
So it was mostly a CIA operation not unlike Iran-Contra.

Still, arming the muzzie bros is not a good idea.

3 posted on 10/24/2012 8:15:19 PM PDT by Paladin2
[ Post Reply | Private Reply | To 1 | View Replies]

To: All
Klein believes that Obama would prefer the discussion be about his competence in defending a US outpost rather than have the discussion be about him arming Islamic jihadists.
4 posted on 10/24/2012 8:15:28 PM PDT by Dajjal (Justice Robert Jackson was wrong -- the Constitution IS a suicide pact.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: All

I wonder whether the building was also used to warehouse the weapons being handed out — or, at least, whether the attackers believed that weapons were being stored there.


5 posted on 10/24/2012 8:19:03 PM PDT by Dajjal (Justice Robert Jackson was wrong -- the Constitution IS a suicide pact.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Dajjal

According to Bret Baeirs report, Amb Stevens met with a fellow diplomat, from Turkey at the site formerly known as the consulate.
Knowing as we do now, that Amb Stevens was getting more and more worried about his plight in the days immediately before the attack.

Was he asking for help from the Turkish diplomat? Or was it regarding plans to move the weapons?


6 posted on 10/24/2012 8:21:08 PM PDT by uncitizen (Religion of Peace my hind end)
[ Post Reply | Private Reply | To 4 | View Replies]

To: Dajjal

feeding the alligator, expecting not to be eaten

my dog and I could run the “middle east bureau” better than these ... people


7 posted on 10/24/2012 8:21:08 PM PDT by RobinOfKingston (The instinct toward liberalism is located in the part of the brain called the rectal lobe.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: narses; Pyro7480; NYer; Salvation; AdmSmith; Aquinasfan; Siobhan; Maeve; XR7; SJackson; ...

Benghazi news ping


8 posted on 10/24/2012 8:24:40 PM PDT by Dajjal (Justice Robert Jackson was wrong -- the Constitution IS a suicide pact.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Dajjal

Congress? We don’t need no stinking Congress!


9 posted on 10/24/2012 8:25:01 PM PDT by rfp1234
[ Post Reply | Private Reply | To 1 | View Replies]

To: Dajjal

The U.S. diplomatic mission in Benghazi, Libya, actually served as a meeting place to coordinate aid for the rebel-led insurgencies in the Middle East, according to Middle Eastern security officials.

Okay, since this appears to have been a site used to work against America’s interests, do I have to cheer for the “ambassader’s” murderers? I already have to side with Russia on the situation in Syria.


10 posted on 10/24/2012 8:25:01 PM PDT by freedomfiter2 (Brutal acts of commission and yawning acts of omission both strengthen the hand of the devil.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Dajjal

bttt


11 posted on 10/24/2012 8:25:23 PM PDT by Just mythoughts (Please help Todd Akin defeat Claire and the GOP-e send money!!!!!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Dajjal

Well then it was very stupid to have the ambassador’s office there.


12 posted on 10/24/2012 8:41:22 PM PDT by HiTech RedNeck (cat dog, cat dog, alone in the world is a little cat dog)
[ Post Reply | Private Reply | To 1 | View Replies]

To: freedomfiter2
RE: "side with Russia on the situation in Syria."

Benghazi.. who really done it?

GAFFNEY: The real reason behind Benghazigate

[Who done it?] Jihadists don't like us and would attack us, just as they would any enemy, is plausible on the surface, ... but under closer scrutiny doesn't pass the smell test.

Assad benefits from the destruction that just may end the U.S. activity in Libya, who is ruthless as hell and helping Assad?

I know! I know! I know who done it! Putin.

LBJ and Nixon covered up the Soviet destruction of, and deaths of all aboard, our USS Scorpion.

13 posted on 10/24/2012 8:42:39 PM PDT by WilliamofCarmichael (If modern America's Man on Horseback is out there, Get on the damn horse already!)
[ Post Reply | Private Reply | To 10 | View Replies]

To: Dajjal

Pleased to meet you. Hope you guess my name.

But what's puzzling you is the nature of my game.

14 posted on 10/24/2012 8:48:54 PM PDT by chris37 (Heartless.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: WilliamofCarmichael

Didn’t obama and Putin have a spat over Syria? Putin was sending troops to Syria to evacuate their people. That was his story anyway.


15 posted on 10/24/2012 8:51:01 PM PDT by virgil
[ Post Reply | Private Reply | To 13 | View Replies]

To: chris37

She was right: http://m.youtube.com/#/watch?v=0SQTxxkdSIs&desktop_uri=%2Fwatch%3Fv%3D0SQTxxkdSIs


16 posted on 10/24/2012 8:54:55 PM PDT by stayathomemom (Beware of kittens modifying your posts.)
[ Post Reply | Private Reply | To 14 | View Replies]

To: Dajjal

Well, I’lbee,, if this story is anywhere close to what happened in Benghazi, I may not feel so bad about the ambasador and his people, amd I might begin to understand why the President choose to lie and blame that movie, after all it is much the lesser of two evils, much as that blue dress and I did not have sexual relation with that woman was better for Clinton than the money laundering donation from China and Indonesia. that stupid movie might just be the blue dress with stains on it, time will tell, but likely not until after the election, no mather who winns it


17 posted on 10/24/2012 8:58:37 PM PDT by munin
[ Post Reply | Private Reply | To 1 | View Replies]

To: virgil
Yes and over the past year various Internet sources like Fox report: "Mar 19, 2012 - Reports of Russian anti-terror troops on the ground in Syria is raising new concerns . . . ."

Vladimir Putin’s comments on events in Libya

We must work together to bring peace to the world, says Putin.. yeah right! I remember the entire Cold War.. in Russian that means.. submit!

18 posted on 10/24/2012 9:01:23 PM PDT by WilliamofCarmichael (If modern America's Man on Horseback is out there, Get on the damn horse already!)
[ Post Reply | Private Reply | To 15 | View Replies]

To: stayathomemom

Oh yes, yes she was.

I would say at this point that the enemy infiltration of our government is complete and it goes to the highest office the land. There is no doubt in my mind at all.

I think that this is going to get much, much worse very quickly.


19 posted on 10/24/2012 9:02:45 PM PDT by chris37 (Heartless.)
[ Post Reply | Private Reply | To 16 | View Replies]

To: Dajjal

It is then very possible that Syrians were behind false flagging this attack.


20 posted on 10/24/2012 9:03:41 PM PDT by TomasUSMC ( FIGHT LIKE WW2, FINISH LIKE WW2. FIGHT LIKE NAM, FINISH LIKE NAM)
[ Post Reply | Private Reply | To 1 | View Replies]

To: LucyT

ping


21 posted on 10/24/2012 10:27:40 PM PDT by Fractal Trader
[ Post Reply | Private Reply | To 1 | View Replies]

To: Fractal Trader; penelopesire; MestaMachine; KC_Lion; Godzilla; Domestic Church; dragonblustar; ...

*
*

Article, then # 4 , # 19.

Thanks, Fractal Trader.

.


22 posted on 10/24/2012 11:08:39 PM PDT by LucyT
[ Post Reply | Private Reply | To 21 | View Replies]

To: Paladin2
So it was mostly a CIA operation not unlike Iran-Contra.

At least Iran Contra had the goal of obtaining the release of 7 American hostages - can't find anything remotely pro-American in this deal.

23 posted on 10/25/2012 2:57:57 AM PDT by trebb (Allies no longer trust us. Enemies no longer fear us.)
[ Post Reply | Private Reply | To 3 | View Replies]

To: chris37

24 posted on 10/25/2012 3:17:59 AM PDT by Fresh Wind (If Obama is an empty chair, then Biden is the whoopee cushion.)
[ Post Reply | Private Reply | To 14 | View Replies]

To: Fresh Wind; mickie
Wow, he sure does have the stink-eye, doesn't he!

I just rubbed some old-world garlic across my computer screen.

Leni

25 posted on 10/25/2012 3:38:50 AM PDT by MinuteGal
[ Post Reply | Private Reply | To 24 | View Replies]

To: MinuteGal

Two evil faces. One was just an actor, one is the president.


26 posted on 10/25/2012 3:41:59 AM PDT by Fresh Wind (If Obama is an empty chair, then Biden is the whoopee cushion.)
[ Post Reply | Private Reply | To 25 | View Replies]

To: WilliamofCarmichael

Even if Russia was behind the Benghazi attack they are still doing a better job of working for US interests than the Obama administration is.


27 posted on 10/25/2012 4:14:54 AM PDT by freedomfiter2 (Brutal acts of commission and yawning acts of omission both strengthen the hand of the devil.)
[ Post Reply | Private Reply | To 13 | View Replies]

To: hoosiermama; penelopesire; thouworm; Protect the Bill of Rights; LucyT; SE Mom; MestaMachine; ...

More CYA ... but maybe some relevant facts. Does it seem she was assuming Stevens was kidnapped??

http://online.wsj.com/article/SB10000872396390443684104578066631931377740.html

(snip)

In the Benghazi crisis, she made a previously undisclosed call to Libyan President Mohammed Magarief seeking immediate help in finding the missing U.S. ambassador,

(snip)

Then on Sept. 11, the State Department at 4 p.m. received an alert from its Libyan embassy in Tripoli. The U.S. ambassador, Mr. Stevens, visiting the Benghazi consulate, had delivered a one-sentence message: “We’re under attack.”

At 4:20 p.m., State Department executive secretary Steve Mull alerted Mrs. Clinton in her office. According to a person present, Mrs. Clinton asked, “How are we getting more security on the ground? More communication on the ground?”

And she said: “Find Chris,” the U.S. ambassador. She had handpicked him for the posting.

At 5 p.m., Mr. Mull informed her that they couldn’t locate the ambassador or reach his cellphone. But he said the department’s “Ops Center” had an open line with the Tripoli embassy. Mrs. Clinton moved there for a video conference with White House, military and intelligence officials, who ordered increased security regionwide. Mrs. Clinton remained at the State Department until midnight.

Overnight, Mr. Stevens’ body was identified at a Benghazi hospital. Mrs. Clinton returned to the State Department at 7 the next morning to inform the world of the tragedy.

(snip)

+++++++++++++++++++++++++++++++++++++++

http://www.state.gov/r/pa/prs/appt/2012/09/197186.htm

Public Schedule for September 11, 2012

U.S. DEPARTMENT OF STATE
PUBLIC SCHEDULE
TUESDAY SEPTEMBER 11, 2012

SECRETARY HILLARY RODHAM CLINTON

9:20 a.m. Secretary Clinton meets with the Fulbright Foreign Scholarship Board, at the Department of State.
(CLOSED PRESS COVERAGE)

10:15 a.m. Secretary Clinton holds a swearing-in ceremony for U.S. Ambassador to Ghana Gene Cretz, at the Department of State.
(CLOSED PRESS COVERAGE)

12:00 p.m. Secretary Clinton meets with Secretary of Defense Leon Panetta and National Security Adviser Tom Donilon, at the White House.
(MEDIA DETERMINED BY WHITE HOUSE)

2:15 p.m. Secretary Clinton attends the Flag Ceremony for Cameron Munter, at the Department of State.
(CLOSED PRESS COVERAGE)

4:00 p.m. Secretary Clinton holds a swearing-in ceremony for U.S. Ambassador to Serbia Michael Kirby, at the Department of State.
(CLOSED PRESS COVERAGE)

http://www.whitehouse.gov/schedule/complete/2012-09-11

5:00 pm
The President and the Vice President meet with Secretary of Defense
Oval Office
Closed Press

http://articles.boston.com/2012-09-12/world/33776446_1_benghazi-revolt-against-libyan-leader-president-barack-obama

“Obama was informed about the developments in Libya by his National Security Adviser Tom Donilon as the president began a weekly meeting Secretary of Defense Leon Panetta and Chairman of the Joint Chiefs of Staff Martin Dempsey. The White House said Obama was kept apprised throughout the evening and then again Wednesday morning.”


28 posted on 10/25/2012 4:27:16 AM PDT by maggief
[ Post Reply | Private Reply | To 1 | View Replies]

To: Dajjal
Obama can make the discussion about almost anything - he's kept the FBI out of Benghizi - on the bulls*it excuse that it's ‘too dangerous’.

Of course CNN’s been to Benghazi since the slaughter - combing the place down - same with FOX News. Obama's either an idiot, or he's covering something up or he's planting a new story.... maybe something to be accidentally ‘leaked’ to the New York Times a few days before the election? It's hard to believe he and Hillary would be able to turn down cries for help for over 5 hours - especially with so many groups ready to go in and save these people - unless that had a plausible excuse. Or something that sounded plausible... something that would keep everyone in line.

If the excuse was a lie (to help with his reelection) - meant to be a trap for those who would naturally condemn the killing and rape of four Americans, then he's a monster. Obama's not good at running the country - unless the goal is to destroy what we have - but he is good at protecting himself. Lying isn't an issue for him. Look at the Letterman and GM lie - one that's gone on forever. No guilt or hesitation... Lost my train of thought - - anyhow I'll feel relieved when the election's over and the Benghazi mess can be looked at with honest eyes...

29 posted on 10/25/2012 4:44:03 AM PDT by GOPJ (Obama on Benghazi - - http://www.youtube.com/watch?v=nE-aorbApBw&feature=plcp)
[ Post Reply | Private Reply | To 4 | View Replies]

To: maggief

Nobody mentions petraeus. You can’t connect all the dots on this if you don’t have all the dots. petraeus is into this up to his eyeballs...and it isn’t the first time.


30 posted on 10/25/2012 6:50:10 AM PDT by MestaMachine (obama kills and none dare call it treason)
[ Post Reply | Private Reply | To 28 | View Replies]

To: MestaMachine

bttt


31 posted on 10/25/2012 7:04:42 AM PDT by ConservativeMan55
[ Post Reply | Private Reply | To 30 | View Replies]

To: MestaMachine

Same with this guy.

http://bangordailynews.com/2012/10/25/politics/a-cia-veteran-transforms-u-s-counterterrorism-policy/?ref=latest


32 posted on 10/25/2012 7:09:26 AM PDT by maggief
[ Post Reply | Private Reply | To 30 | View Replies]

To: maggief

Wow. In this article, I couldn’t tell if it was a profile or if they were nominating this bastich for sainthood.


33 posted on 10/25/2012 7:25:13 AM PDT by MestaMachine (obama kills and none dare call it treason)
[ Post Reply | Private Reply | To 32 | View Replies]

To: chris37
No sympathy is due for that devil.

Obama had to know and approve of the idea of running arms to radical Islamists in league with the Muslim Brotherhood and al Qaeda in order to help overthrow regimes in Libya and Syria. Allowing Ambassador Stevens and others to die in order to cover up their complicity in that scheme was pure evil. Worse: Hillary Clinton knows the truth and refuses to speak. And worse than that: so does General Petraeus.

34 posted on 10/25/2012 7:29:55 AM PDT by andy58-in-nh (Cogito, ergo armatum sum.)
[ Post Reply | Private Reply | To 14 | View Replies]

To: MestaMachine

Unreal, isn’t it?

Then there’s the WSJ HRC report I posted above. MSM is putting lipstick on the pigs.


35 posted on 10/25/2012 7:43:38 AM PDT by maggief
[ Post Reply | Private Reply | To 33 | View Replies]

To: andy58-in-nh
Obama had to know and approve of the idea of running arms to radical Islamists

But who's idea was it originally? We need that person named and everyone down the line who went along with it.

I will always blame the GOP for everything that's been done the last four years. They failed to vet him and they knew yet "evaded" the situation at each and every turn.

36 posted on 10/25/2012 7:58:18 AM PDT by bgill (Evil doers are in every corner of our government. Have we passed the time of no return?)
[ Post Reply | Private Reply | To 34 | View Replies]

To: maggief; MestaMachine

” “Ever since the first couple of months, I felt there was a real similarity of views that gave me a sense of comfort,” Brennan said. “I don’t think we’ve had a disagreement.””

Of course there was no disagreement, Brennan. How could a dummy like Obama disagree with that which he can’t understand to begin with ?

Brennan is a bad liar as well.


37 posted on 10/25/2012 8:57:19 AM PDT by stephenjohnbanker ((God, family, country, mom, apple pie, the girl next door and a Ford F250 to pull my boat.))
[ Post Reply | Private Reply | To 32 | View Replies]

To: maggief

Don’t subscribe to WSJ.

1) Do you have another link to the full article?
2) Are there any additional time/hour points in WSJ article?


38 posted on 10/25/2012 10:49:02 AM PDT by thouworm (.)
[ Post Reply | Private Reply | To 28 | View Replies]

To: gandalftb

ping


39 posted on 10/25/2012 1:45:28 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Dajjal; Cronos; no-to-illegals; cradle of freedom; Eleutheria5

Thanks for the ping.
Unsurprising.
The ‘jihadist’, ‘mujahedin’, ‘islamist’ support has been going on for over 3 decades in the ME, North Africa and generally the muslim world.
I continue to say: don’t forget Jimmy Carter and Brzezinski’s doctrine of “Islamic Green Belt”. That was just a start. Very dangerous stuff.
When you make deals with the Devil, sooner or later he will come to collect.


40 posted on 10/25/2012 5:51:44 PM PDT by odds
[ Post Reply | Private Reply | To 8 | View Replies]

To: Dajjal

Although no one knows the answer to that question for sure, there were two large garage-like buildings next door that were mysteriously emptied out.


41 posted on 10/26/2012 12:10:23 AM PDT by Juliathemechanic (Weapons Storage?)
[ Post Reply | Private Reply | To 5 | View Replies]

To: odds
When you make deals with the Devil, sooner or later he will come to collect.

Very true odds, and Thank You for the ping. Those media folks are in for some kind of lesson once they realize what they have done. The bad thing about making a deal with the devil is both God and the devil go at the one having made the deal with the devil. An intelligent individual would make a deal with only God. Only a stupid person desires the wrath of both the devil and God.

42 posted on 10/27/2012 3:47:23 PM PDT by no-to-illegals (Please God, Protect and Bless Our Men and Women in Uniform with Victory. Amen.)
[ Post Reply | Private Reply | To 40 | View Replies]

To: odds

I would like to know more about Brezinski’s Green Belt.


43 posted on 10/28/2012 7:18:13 PM PDT by cradle of freedom (Long live the Republic !)
[ Post Reply | Private Reply | To 40 | View Replies]

To: cradle of freedom

Here are a few links:

http://www.humanevents.com/2007/06/01/left-should-go-right/
http://www.newenglishreview.org/blog_print_link.cfm/blog_id/1863
http://www.globalresearch.ca/us-is-no-stranger-to-double-dealing-the-role-of-pakistan-s-inter-services-intelligence-isi-and-its-links-to-the-cia/20386

There are also some good youtube videos where he is interviewed in parts about Islamic Green Belt theory and strategy which was devised to incite USSR invasion of Afghanistan in order to defeat them by supporting the Islamic mujahedin in Afghanistan.

Additionally, I’d suggest reading Brzezinski’s own books about geostrategy in Eurasia. 1) Game Plan (1986) and 2)The Grand Chessboard (1997).


44 posted on 10/30/2012 4:28:57 PM PDT by odds
[ Post Reply | Private Reply | To 43 | View Replies]

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson