Skip to comments.
Cancer Cells Can't Proliferate and Invade at the Same Time
Scientific American ^
| 1/1/16
| Viviane Callier
Posted on 01/04/2016 12:40:51 AM PST by LibWhacker
Cancer Cells Can't Proliferate and Invade at the Same Time
The new findings could inform cancer treatments, which typically target only cells that are dividing
Lumps and hairlike projections are characteristic of cancer cells, such as the cervical cancer cell shown here.
STEVE GSCHMEISSNER Science Source
Advertisement
The worst cancer cells don't sit still. Instead they metastasizeâmigrate from their original sites and establish new tumors in other parts of the body. Once a cancer spreads, it is harder to eliminate. A study by developmental biologists offers a fresh clue to how cancer cells acquire the ability to invade other tissuesâa prerequisite for metastasis. It reveals that invasion requires cells to stop dividing. Therefore, the two processesâ invasion and proliferationâare mutually exclusive. The finding could inform cancer therapies, which typically target rapidly proliferating cancer cells.
David Matus of Stony Brook University and David Sherwood of Duke University turned to a transparent worm to elucidate this invading process. During the worm's normal development, a cell known as the anchor cell breaks through a structure called the basement membrane, which initially separates the uterus from the vulva. The process is similar to how human cancer cells invade basement membranes to enter the bloodstream, which carries them to distant sites. So biologists have adopted Caenorhabditis elegans as a metastasis model organism, which they can easily image and genetically manipulate.
After turning on and off hundreds of genes in C. elegans, Matus's team found a gene that regulated anchor cell invasion. When it was turned off, the anchor cell failed to invade the basement membrane. But the anchor cell also did something unexpected: it began to divide. Conversely, when the researchers inhibited cell proliferation, the anchor cell stopped dividing and began to invade again. Further experiments showed that halting cell division was both necessary and sufficient for invasion. Although anecdotal observations by pathologists have suggested this either/or situation might be the case, the new study is the first to uncover the genetic mechanism that explains why these two processes must be mutually exclusive. The results were published in October in the journal Developmental Cell.
The study also explains the long-standing but mysterious observation by cancer biologists that the invading front of many tumors does not contain dividing cells; instead the invasive cells lead the dividing cells behind them and push forward into healthy tissue as the tumor grows in size. âThis research changes how we think about cancer at some level,â Matus says. âWe think of cancer as a disease of uncontrolled cell division, and in fact, many cancer drugs are designed to target these dividing cells. But our study suggests that we need to figure out how to target these nondividing cells, too, as these are the ones that are invasive.â
Before the insight makes its way into cancer treatments, however, it will need further testing. âNow we can take that simple model and go to more complex systemsâlike breast cancer tumors,â says Andrew Ewald, a cancer cell biologist at Johns Hopkins University. Metastatic breast cancer alone accounts for about 40,000 deaths every year in the U.S., but the five-year survival rate is nearly 100 percent if caught before the cancer spreads.
TOPICS: Health/Medicine; Science
KEYWORDS: cancer; cancercells; cells; invade; proliferate
Navigation: use the links below to view more comments.
first 1-20, 21-40, 41-53 next last
To: LibWhacker
It’s my humble guess....that within ten years...we will have some ability to find cancer within your body (stage one episode) and somehow turn it off from spreading. You might still die from cancer, but it’ll be twenty-five years later.
To: pepsionice
Oh, I hope so. It’d be fantastic to give everyone a 25-year reprieve.
To: LibWhacker
The cure for cancer is just around the corner . . .
4
posted on
01/04/2016 1:20:17 AM PST
by
Jeff Chandler
(I shot Schroedinger's cat with Chekhov's gun.)
To: LibWhacker
After seeing my brother defeat leukemia twice, I’m always interested in seeing advancements in cancer fighting technologies. This is interesting to say the least.
5
posted on
01/04/2016 1:40:17 AM PST
by
SWAMP-C1PHER
(HOMO, OECONOMIA, ET CIVITAS.)
To: 2ndreconmarine; Fitzcarraldo; Covenantor; Mother Abigail; EBH; Dog Gone; ...
6
posted on
01/04/2016 1:48:03 AM PST
by
Smokin' Joe
(How often God must weep at humans' folly. Stand fast. God knows what He is doing.)
To: Tired of Taxes
7
posted on
01/04/2016 1:54:08 AM PST
by
Smokin' Joe
(How often God must weep at humans' folly. Stand fast. God knows what He is doing.)
To: LibWhacker
Instead of drugs, take minerals to bolster your immune response. Of particular use is iodine, which facilitates apoptosis, the natural death of abnormal cells.
To: LibWhacker
Okay, so:
Step 1) Isolate the gene(s) necessary for cell migration and invasion. They may be homologous to the gene in C. elegans, but are probably more complex (more proteins involved, more control mechanisms).
Step 2) Develop drugs to target those genes, or if those genes cause markers to be expressed on the surfaces of those cells, target the markers. This is complicated by the fact that some normal cells—notably immune system cells—need to invade other tissues in order to function correctly. The big problem with cancer is that the treatment always hits normal cells in addition to the cancer cells.
Step 3) Assuming a drug to stop cell invasion is successfully developed, hit the cancer with a cocktail of drugs meant to stop invasion and growth at the same time.
This sounds like a new avenue against which to target cancer therapy, but it will not be a silver bullet. Cancer is too complex, and the difficulty of finding a therapy that targets the cancer and not healthy cells is nearly insurmountable. Also, it will be more than a decade before anything hits the market. And that is speaking optimistically.
9
posted on
01/04/2016 4:39:29 AM PST
by
exDemMom
(Current visual of the hole the US continues to dig itself into: http://www.usdebtclock.org/)
To: spacejunkie2001
Yes and supplement with magnesium and selenium to help the iodine do its job.
10
posted on
01/04/2016 5:00:14 AM PST
by
petercooper
(Coexist my ass!)
To: exDemMom; LibWhacker
These genes probably as well regulate how wounds are healed, so it might have bad side effects.
11
posted on
01/04/2016 5:31:10 AM PST
by
AdmSmith
(GCTGATATGTCTATGATTACTCAT)
To: LibWhacker
During the worm’s normal development, a cell known as the anchor cell breaks through a structure called the basement membrane, which initially separates the uterus from the vulva.....
As far as I know, the basement membrane separates the skin cells from the underlying tissue. An epithelial cancer is considered invasive when it has breached the basement membrane, which gives it access to the underlying tissue and allows it to metastasize all over the body. Most skin cancers initially metastasize through direct extension. I don’t know where the author got the info that the basement membrane separates the uterus from the vulva. And this is in the very respectable Scientific American? To me, this makes the entire premise suspect. And just a side comment......I was in cancer detection for decades and came to the conclusion that the Group/Person funding any research project WILL get the result they desire. Sad, but true.
12
posted on
01/04/2016 6:33:49 AM PST
by
originalbuckeye
("In a time of universal deceit, telling the truth is a revolutionary act." - George Orwell)
To: petercooper
oh dang! you’re good :) I’m on the iodine protocol, which includes Iodoral, mag, selenium salt and vit c.
I think lots of ailments can be completed obliterated if people took minerals.
To: spacejunkie2001
Vitamin B17, found in apricot kernels, also causes apoptosis.
14
posted on
01/04/2016 7:01:30 AM PST
by
petercooper
(Coexist my ass!)
To: petercooper
I can’t take iodine (hashimotos)...wondering if I can take b17...interesting
15
posted on
01/04/2016 7:31:32 AM PST
by
goodnesswins
(hey..Wussie Americans....ISIS is coming. Are you ready?)
To: goodnesswins
16
posted on
01/04/2016 8:40:20 AM PST
by
petercooper
(Coexist my ass!)
To: petercooper; goodnesswins
To: spacejunkie2001
How do you take your iodine? It’s bit scary. From foods like seaweed, or one of the protocols?
18
posted on
01/04/2016 10:21:34 AM PST
by
Yaelle
(Since PC is not actually "correct," it should be renamed Political Pandering.)
To: spacejunkie2001
I would love to hear details of your protocol. I have two different issues that sometimes lead to cancer and I’m all about diet and natural prevention.
19
posted on
01/04/2016 10:25:03 AM PST
by
Yaelle
(Since PC is not actually "correct," it should be renamed Political Pandering.)
To: petercooper
Wow, I am ordering these.
20
posted on
01/04/2016 10:33:27 AM PST
by
Yaelle
(Since PC is not actually "correct," it should be renamed Political Pandering.)
Navigation: use the links below to view more comments.
first 1-20, 21-40, 41-53 next last
Disclaimer:
Opinions posted on Free Republic are those of the individual
posters and do not necessarily represent the opinion of Free Republic or its
management. All materials posted herein are protected by copyright law and the
exemption for fair use of copyrighted works.
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson